\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501503830:

Variant ID: vg0501503830 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1503830
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTGGGCTGCCACCTCTGTGGCCACCCCAAGCATATCAAGTGATGCCGCATTTGCCTCAGGATTCCATTTCTTTCCAGATACTGCTCCTAGGTAATTG[T/C]
TGGCAGGTTGCTGTTGCTGCCGAAGATCAAGAAGTTTCTTAACTTCTCGGAAACTATCAGATTTATGGTGCTTGTAGTAGAACTCAATACAATCAGCAGT

Reverse complement sequence

ACTGCTGATTGTATTGAGTTCTACTACAAGCACCATAAATCTGATAGTTTCCGAGAAGTTAAGAAACTTCTTGATCTTCGGCAGCAACAGCAACCTGCCA[A/G]
CAATTACCTAGGAGCAGTATCTGGAAAGAAATGGAATCCTGAGGCAAATGCGGCATCACTTGATATGCTTGGGGTGGCCACAGAGGTGGCAGCCCAAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 25.00% 0.13% 0.06% NA
All Indica  2759 85.50% 14.20% 0.18% 0.11% NA
All Japonica  1512 49.60% 50.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.30% 4.40% 0.34% 0.00% NA
Indica II  465 64.70% 34.80% 0.22% 0.22% NA
Indica III  913 91.10% 8.90% 0.00% 0.00% NA
Indica Intermediate  786 83.70% 15.80% 0.25% 0.25% NA
Temperate Japonica  767 10.70% 89.30% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.60% 0.20% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501503830 T -> DEL LOC_Os05g03550.1 N frameshift_variant Average:49.823; most accessible tissue: Minghui63 young leaf, score: 75.006 N N N N
vg0501503830 T -> C LOC_Os05g03550.1 missense_variant ; p.Asn792Ser; MODERATE nonsynonymous_codon Average:49.823; most accessible tissue: Minghui63 young leaf, score: 75.006 benign -1.45 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501503830 T C 0.0 0.01 0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501503830 NA 5.22E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 4.52E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 1.54E-06 1.10E-15 mr1486 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 2.55E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 2.59E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 3.28E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 2.86E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 4.35E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 1.88E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 2.87E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 2.63E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 3.77E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 1.18E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 2.25E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 9.43E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501503830 NA 3.00E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251