Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500579675:

Variant ID: vg0500579675 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 579675
Reference Allele: GAlternative Allele: GA,GAA
Primary Allele: GASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAGTCAGACACAATTACACAAATCACAAAATTCCCAACACAGAGATATGACTGATTGATTGGATACTTCAGAAATTTTTTTTAAAAAAAAAACTAAAG[G/GA,GAA]
AAAAAAAAAGGAATAAACATAGCATACATGTCTAGATTCTAATCACCATAGTAAGAAATGCTATATGGAGGAAGGAAGAAGAGAGGAGAAAGGTGAGACG

Reverse complement sequence

CGTCTCACCTTTCTCCTCTCTTCTTCCTTCCTCCATATAGCATTTCTTACTATGGTGATTAGAATCTAGACATGTATGCTATGTTTATTCCTTTTTTTTT[C/TC,TTC]
CTTTAGTTTTTTTTTTAAAAAAAATTTCTGAAGTATCCAATCAATCAGTCATATCTCTGTGTTGGGAATTTTGTGATTTGTGTAATTGTGTCTGACTTGT

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 32.40% 0.25% 0.00% GAA: 0.11%
All Indica  2759 96.70% 2.90% 0.18% 0.00% GAA: 0.18%
All Japonica  1512 11.40% 88.60% 0.07% 0.00% NA
Aus  269 92.20% 5.90% 1.86% 0.00% NA
Indica I  595 98.00% 1.70% 0.34% 0.00% NA
Indica II  465 93.30% 6.50% 0.00% 0.00% GAA: 0.22%
Indica III  913 97.70% 1.90% 0.33% 0.00% GAA: 0.11%
Indica Intermediate  786 96.70% 2.90% 0.00% 0.00% GAA: 0.38%
Temperate Japonica  767 7.00% 93.00% 0.00% 0.00% NA
Tropical Japonica  504 19.60% 80.40% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 91.70% 0.41% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500579675 G -> GA LOC_Os05g02010.1 downstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GA LOC_Os05g02010.2 downstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GA LOC_Os05g02010.3 downstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GA LOC_Os05g02010.4 downstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GA LOC_Os05g02020.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GA LOC_Os05g02020.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GAA LOC_Os05g02010.1 downstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GAA LOC_Os05g02010.2 downstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GAA LOC_Os05g02010.3 downstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GAA LOC_Os05g02010.4 downstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GAA LOC_Os05g02020.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579675 G -> GAA LOC_Os05g02020.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500579675 G GA 0.02 -0.11 -0.1 0.02 0.01 0.01
vg0500579675 G GAA 0.02 -0.07 -0.08 0.03 0.06 0.09