Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500579657:

Variant ID: vg0500579657 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 579657
Reference Allele: TTAAAlternative Allele: TA,T,TATAA,ATAA
Primary Allele: TASecondary Allele: TTAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCTATACTAGTAACACACAAGTCAGACACAATTACACAAATCACAAAATTCCCAACACAGAGATATGACTGATTGATTGGATACTTCAGAAATTTTTT[TTAA/TA,T,TATAA,ATAA]
AAAAAAAACTAAAGGAAAAAAAAAGGAATAAACATAGCATACATGTCTAGATTCTAATCACCATAGTAAGAAATGCTATATGGAGGAAGGAAGAAGAGAG

Reverse complement sequence

CTCTCTTCTTCCTTCCTCCATATAGCATTTCTTACTATGGTGATTAGAATCTAGACATGTATGCTATGTTTATTCCTTTTTTTTTCCTTTAGTTTTTTTT[TTAA/TA,A,TTATA,TTAT]
AAAAAATTTCTGAAGTATCCAATCAATCAGTCATATCTCTGTGTTGGGAATTTTGTGATTTGTGTAATTGTGTCTGACTTGTGTGTTACTAGTATAGGAC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of TTAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 33.60% 2.09% 1.63% T: 0.28%; ATAA: 0.17%; TATAA: 0.02%
All Indica  2759 91.00% 8.10% 0.43% 0.00% T: 0.47%
All Japonica  1512 4.50% 84.60% 5.69% 4.89% ATAA: 0.26%; TATAA: 0.07%
Aus  269 84.80% 14.90% 0.37% 0.00% NA
Indica I  595 97.30% 2.40% 0.17% 0.00% T: 0.17%
Indica II  465 94.00% 5.80% 0.22% 0.00% NA
Indica III  913 81.80% 16.00% 0.88% 0.00% T: 1.31%
Indica Intermediate  786 95.00% 4.70% 0.25% 0.00% NA
Temperate Japonica  767 7.30% 91.00% 0.52% 1.04% TATAA: 0.13%
Tropical Japonica  504 0.00% 75.00% 15.28% 8.93% ATAA: 0.79%
Japonica Intermediate  241 5.00% 84.20% 2.07% 8.71% NA
VI/Aromatic  96 93.80% 5.20% 0.00% 0.00% ATAA: 1.04%
Intermediate  90 48.90% 44.40% 0.00% 3.33% ATAA: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500579657 TTAA -> TATAA LOC_Os05g02010.1 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TATAA LOC_Os05g02010.2 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TATAA LOC_Os05g02010.3 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TATAA LOC_Os05g02010.4 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TATAA LOC_Os05g02020.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TATAA LOC_Os05g02020.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> T LOC_Os05g02010.1 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> T LOC_Os05g02010.2 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> T LOC_Os05g02010.3 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> T LOC_Os05g02010.4 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> T LOC_Os05g02020.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> T LOC_Os05g02020.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TA LOC_Os05g02010.1 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TA LOC_Os05g02010.2 downstream_gene_variant ; 2792.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TA LOC_Os05g02010.3 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TA LOC_Os05g02010.4 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TA LOC_Os05g02020.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> TA LOC_Os05g02020.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> ATAA LOC_Os05g02010.1 downstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> ATAA LOC_Os05g02010.2 downstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> ATAA LOC_Os05g02010.3 downstream_gene_variant ; 2776.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> ATAA LOC_Os05g02010.4 downstream_gene_variant ; 2776.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> ATAA LOC_Os05g02020.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0500579657 TTAA -> ATAA LOC_Os05g02020.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500579657 TTAA ATAA 0.02 0.01 0.01 0.0 0.0 -0.01
vg0500579657 TTAA T -0.17 -0.15 -0.12 -0.04 -0.05 -0.03
vg0500579657 TTAA TA -0.14 -0.15 -0.16 0.0 -0.03 -0.05
vg0500579657 TTAA TATAA 0.03 -0.08 -0.09 -0.09 -0.09 -0.06