Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0500579017:

Variant ID: vg0500579017 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 579017
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAGTCCTCAGCTCATTGAAGGCAAAGGCCTTGACATTTGCTGCCTCCAGGATCTCATCCTCGCTCCGTGGTGTTGGCGGCACCGAGGCTGCAGACACA[C/T]
TGGAGTTGCTAGCATACTTGGATGTCCCCCCTAAACAACAGAAGACAGTACAAATTTTCAGGCCGTGGTCCATTAGATTTTAGCCTGATCAAGTTGTTGT

Reverse complement sequence

ACAACAACTTGATCAGGCTAAAATCTAATGGACCACGGCCTGAAAATTTGTACTGTCTTCTGTTGTTTAGGGGGGACATCCAAGTATGCTAGCAACTCCA[G/A]
TGTGTCTGCAGCCTCGGTGCCGCCAACACCACGGAGCGAGGATGAGATCCTGGAGGCAGCAAATGTCAAGGCCTTTGCCTTCAATGAGCTGAGGACTGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 19.60% 0.00% 0.00% NA
All Indica  2759 78.20% 21.80% 0.00% 0.00% NA
All Japonica  1512 96.20% 3.80% 0.00% 0.00% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 71.10% 28.90% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 73.40% 26.60% 0.00% 0.00% NA
Indica Intermediate  786 78.90% 21.10% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0500579017 C -> T LOC_Os05g02020.1 missense_variant ; p.Ser33Asn; MODERATE nonsynonymous_codon ; S33N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 unknown unknown TOLERATED 0.13
vg0500579017 C -> T LOC_Os05g02020.2 missense_variant ; p.Ser31Asn; MODERATE nonsynonymous_codon ; S31N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 unknown unknown TOLERATED 0.12

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0500579017 C T -0.04 -0.04 -0.04 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0500579017 NA 1.89E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.54E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 4.89E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 3.83E-08 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 5.67E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 6.06E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 3.71E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.17E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 5.66E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 3.04E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.48E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.04E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.34E-08 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 2.07E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.08E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 6.38E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.15E-12 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0500579017 NA 1.79E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251