Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0433154468:

Variant ID: vg0433154468 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 33154468
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CAACCAAATGGCGGCACAAAGAAATAATTTAACGACTCGTGCACGCGCATTATATTTCTTACTCGTGCCGATAACTACGTTGATGCATGCTAATGCTTGT[G/A]
TGTGACGTATTCTTCCCCGGTTATAGCATGTGTGCCCATGCGAAGGTACGTGTTTGGTTCATATGTAACTGATCGATTATCCATCACCGGTTAATTAAGC

Reverse complement sequence

GCTTAATTAACCGGTGATGGATAATCGATCAGTTACATATGAACCAAACACGTACCTTCGCATGGGCACACATGCTATAACCGGGGAAGAATACGTCACA[C/T]
ACAAGCATTAGCATGCATCAACGTAGTTATCGGCACGAGTAAGAAATATAATGCGCGTGCACGAGTCGTTAAATTATTTCTTTGTGCCGCCATTTGGTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 35.00% 0.53% 0.00% NA
All Indica  2759 86.60% 13.30% 0.11% 0.00% NA
All Japonica  1512 19.20% 79.60% 1.26% 0.00% NA
Aus  269 85.50% 13.40% 1.12% 0.00% NA
Indica I  595 95.60% 4.00% 0.34% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 77.10% 22.90% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.70% 0.13% 0.00% NA
Temperate Japonica  767 6.30% 91.50% 2.22% 0.00% NA
Tropical Japonica  504 39.70% 59.90% 0.40% 0.00% NA
Japonica Intermediate  241 17.40% 82.60% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0433154468 G -> A LOC_Os04g55700.1 upstream_gene_variant ; 1176.0bp to feature; MODIFIER silent_mutation Average:89.527; most accessible tissue: Zhenshan97 root, score: 98.703 N N N N
vg0433154468 G -> A LOC_Os04g55690.1 downstream_gene_variant ; 3958.0bp to feature; MODIFIER silent_mutation Average:89.527; most accessible tissue: Zhenshan97 root, score: 98.703 N N N N
vg0433154468 G -> A LOC_Os04g55700-LOC_Os04g55710 intergenic_region ; MODIFIER silent_mutation Average:89.527; most accessible tissue: Zhenshan97 root, score: 98.703 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0433154468 G A -0.05 -0.05 -0.03 -0.04 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0433154468 3.92E-06 5.22E-08 mr1742 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433154468 NA 1.84E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433154468 NA 5.66E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0433154468 NA 2.08E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251