Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0432301849:

Variant ID: vg0432301849 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 32301849
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCTTCCATCATTTCGATCATAAATTTTACGGTGCAGTATCAAAAGAACAGAACACCTTTCTCCCAGAAAGTTTGGATCTTAAATTGATGACACGGCC[G/T]
GATTTTTGCGTGCATGACCGTAAAAGTGGTCAGTTCATAAATTGTTCTAGACGACACAATCACAAAGGCAAAATGACCCATGAAGCAATTGTACTCAAGT

Reverse complement sequence

ACTTGAGTACAATTGCTTCATGGGTCATTTTGCCTTTGTGATTGTGTCGTCTAGAACAATTTATGAACTGACCACTTTTACGGTCATGCACGCAAAAATC[C/A]
GGCCGTGTCATCAATTTAAGATCCAAACTTTCTGGGAGAAAGGTGTTCTGTTCTTTTGATACTGCACCGTAAAATTTATGATCGAAATGATGGAAGAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 26.30% 0.13% 0.00% NA
All Indica  2759 93.60% 6.20% 0.18% 0.00% NA
All Japonica  1512 32.30% 67.60% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 90.90% 8.70% 0.34% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 92.40% 7.30% 0.38% 0.00% NA
Temperate Japonica  767 23.50% 76.40% 0.13% 0.00% NA
Tropical Japonica  504 47.80% 52.20% 0.00% 0.00% NA
Japonica Intermediate  241 28.20% 71.80% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432301849 G -> T LOC_Os04g54240.1 3_prime_UTR_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:68.718; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N
vg0432301849 G -> T LOC_Os04g54230.1 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:68.718; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N
vg0432301849 G -> T LOC_Os04g54250.1 downstream_gene_variant ; 2968.0bp to feature; MODIFIER silent_mutation Average:68.718; most accessible tissue: Minghui63 panicle, score: 92.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0432301849 G T 0.05 0.04 0.03 0.01 0.03 0.02