Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0432167290:

Variant ID: vg0432167290 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 32167290
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: CASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCATCCCCGACCCGGCCGCCGTCGCCGCCGTGCCGCAGCCGGGGCTCGCCGGCTTCACCGACTGGACCCAGCCTTTCATGTGAGTTATATATACAAGC[CA/TA,C]
ATTAATTAACTCGTACTAGCTACCATATCATATGGAGAGCTAGCTTAGCTGAGATCGATCCTGACATGTTTGCATGCGATTTTGTGTACGTTTCATCAGG

Reverse complement sequence

CCTGATGAAACGTACACAAAATCGCATGCAAACATGTCAGGATCGATCTCAGCTAAGCTAGCTCTCCATATGATATGGTAGCTAGTACGAGTTAATTAAT[TG/TA,G]
GCTTGTATATATAACTCACATGAAAGGCTGGGTCCAGTCGGTGAAGCCGGCGAGCCCCGGCTGCGGCACGGCGGCGACGGCGGCCGGGTCGGGGATGCTC

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.30% 0.04% 0.00% C: 0.04%
All Indica  2759 98.60% 1.30% 0.04% 0.00% C: 0.07%
All Japonica  1512 88.60% 11.40% 0.07% 0.00% NA
Aus  269 37.90% 62.10% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.20% 0.50% 0.00% 0.00% C: 0.22%
Indica Intermediate  786 98.30% 1.50% 0.13% 0.00% NA
Temperate Japonica  767 94.10% 5.90% 0.00% 0.00% NA
Tropical Japonica  504 77.60% 22.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.41% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0432167290 CA -> C LOC_Os04g53980.1 upstream_gene_variant ; 1617.0bp to feature; MODIFIER silent_mutation Average:77.36; most accessible tissue: Callus, score: 88.108 N N N N
vg0432167290 CA -> C LOC_Os04g53990.1 intron_variant ; MODIFIER silent_mutation Average:77.36; most accessible tissue: Callus, score: 88.108 N N N N
vg0432167290 CA -> TA LOC_Os04g53980.1 upstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:77.36; most accessible tissue: Callus, score: 88.108 N N N N
vg0432167290 CA -> TA LOC_Os04g53990.1 intron_variant ; MODIFIER silent_mutation Average:77.36; most accessible tissue: Callus, score: 88.108 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0432167290 NA 9.78E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 2.72E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 9.12E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 6.19E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 2.31E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 1.96E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 4.13E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 NA 1.84E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 2.91E-08 NA mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0432167290 2.06E-07 NA mr1550 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251