\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431158473:

Variant ID: vg0431158473 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31158473
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGTGTTTTATTTTCCGTTTTTAAGGGGGAATCGGATCTAGAGTCGGGCTTTTTGTTCGTTTCTGAGAGGGAGTCGGACTTTATTATTATTATTTTTTC[A/G]
CTATTTATTTTGTTTTGATGGGAGTCGGACTTTTTTTTATTTTTTTCGTTATTTATTTTGTTTTGACGGGAGTCGGACTTTTTTTATATATTTTTTTCGC

Reverse complement sequence

GCGAAAAAAATATATAAAAAAAGTCCGACTCCCGTCAAAACAAAATAAATAACGAAAAAAATAAAAAAAAGTCCGACTCCCATCAAAACAAAATAAATAG[T/C]
GAAAAAATAATAATAATAAAGTCCGACTCCCTCTCAGAAACGAACAAAAAGCCCGACTCTAGATCCGATTCCCCCTTAAAAACGGAAAATAAAACACACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 13.70% 1.63% 31.46% NA
All Indica  2759 44.50% 2.40% 1.88% 51.14% NA
All Japonica  1512 62.50% 33.90% 1.26% 2.31% NA
Aus  269 86.60% 11.90% 1.12% 0.37% NA
Indica I  595 29.70% 1.20% 4.20% 64.87% NA
Indica II  465 38.10% 3.90% 0.86% 57.20% NA
Indica III  913 56.80% 2.20% 0.99% 39.98% NA
Indica Intermediate  786 45.30% 2.80% 1.78% 50.13% NA
Temperate Japonica  767 44.30% 53.20% 2.09% 0.39% NA
Tropical Japonica  504 83.30% 10.90% 0.60% 5.16% NA
Japonica Intermediate  241 76.80% 20.70% 0.00% 2.49% NA
VI/Aromatic  96 68.80% 15.60% 0.00% 15.62% NA
Intermediate  90 44.40% 24.40% 3.33% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431158473 A -> DEL N N silent_mutation Average:21.234; most accessible tissue: Callus, score: 46.573 N N N N
vg0431158473 A -> G LOC_Os04g52420.1 downstream_gene_variant ; 3787.0bp to feature; MODIFIER silent_mutation Average:21.234; most accessible tissue: Callus, score: 46.573 N N N N
vg0431158473 A -> G LOC_Os04g52420-LOC_Os04g52440 intergenic_region ; MODIFIER silent_mutation Average:21.234; most accessible tissue: Callus, score: 46.573 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431158473 NA 9.02E-18 Plant_height Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431158473 NA 6.43E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0431158473 NA 2.94E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 9.20E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 9.80E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 8.19E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.48E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 2.99E-07 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.11E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 2.40E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.62E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.64E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.01E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.01E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.23E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 6.41E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 8.08E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 8.09E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.60E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 1.09E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431158473 NA 2.41E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251