\
| Variant ID: vg0430989073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30989073 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )
TTATTTCAAAATAAGTTAATTTGTAATCCGTGATGTTTGTTAAAAATTAGTTGTGCAGTTTGGCGGTTTGATGCCCCTCTCTGCATTAAAGAACTTATAA[T/C]
TGCTGATTGTAATCTCCCTGGTTGAGAAATAAATTCACCCTTTCCCCGCAAAAAAAAATAACTTGTAATTTATAATACAAATGTAGAGAGTAGATAAAAA
TTTTTATCTACTCTCTACATTTGTATTATAAATTACAAGTTATTTTTTTTTGCGGGGAAAGGGTGAATTTATTTCTCAACCAGGGAGATTACAATCAGCA[A/G]
TTATAAGTTCTTTAATGCAGAGAGGGGCATCAAACCGCCAAACTGCACAACTAATTTTTAACAAACATCACGGATTACAAATTAACTTATTTTGAAATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 29.90% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 3.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 26.10% | 73.60% | 0.33% | 0.00% | NA |
| Aus | 269 | 34.90% | 63.90% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.70% | 6.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 42.10% | 57.40% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 94.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.10% | 80.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430989073 | T -> C | LOC_Os04g52140-LOC_Os04g52164 | intergenic_region ; MODIFIER | silent_mutation | Average:56.701; most accessible tissue: Zhenshan97 flower, score: 71.382 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430989073 | NA | 9.84E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 1.32E-10 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 1.09E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 4.03E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 1.01E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 1.94E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 2.86E-07 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 7.35E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 9.57E-07 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 3.05E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 2.25E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 5.41E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | 2.91E-06 | 1.82E-19 | mr1666_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 2.94E-06 | mr1666_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 4.01E-39 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | 6.95E-07 | 5.34E-18 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 3.52E-08 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | 4.95E-06 | 2.85E-10 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430989073 | NA | 1.82E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |