| Variant ID: vg0430916237 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 30916237 |
| Reference Allele: G | Alternative Allele: GA,A,GAA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 345. )
TGGAATGCGGACACCCTTAGGCAAATTCCACACCTTGAGACAGAGTGTAAGACCACGACCACGACCACACCCTTGATTCCTCTTGGTACCTGCTTGAAAG[G/GA,A,GAA]
AAAAAAAAACAATGAGACAATCAGATGAGCATAACAAGAACAGCTGTCAAATGGTGGTGTTCTTTATAGACAGAGTATGAATAAGGAAATGAACAGGATT
AATCCTGTTCATTTCCTTATTCATACTCTGTCTATAAAGAACACCACCATTTGACAGCTGTTCTTGTTATGCTCATCTGATTGTCTCATTGTTTTTTTTT[C/TC,T,TTC]
CTTTCAAGCAGGTACCAAGAGGAATCAAGGGTGTGGTCGTGGTCGTGGTCTTACACTCTGTCTCAAGGTGTGGAATTTGCCTAAGGGTGTCCGCATTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 7.00% | 0.25% | 0.00% | GA: 5.10%; GAA: 0.02% |
| All Indica | 2759 | 89.40% | 2.60% | 0.04% | 0.00% | GA: 7.87%; GAA: 0.04% |
| All Japonica | 1512 | 84.40% | 14.70% | 0.46% | 0.00% | GA: 0.46% |
| Aus | 269 | 82.90% | 10.40% | 1.49% | 0.00% | GA: 5.20% |
| Indica I | 595 | 98.00% | 1.00% | 0.17% | 0.00% | GA: 0.84% |
| Indica II | 465 | 97.00% | 1.30% | 0.00% | 0.00% | GA: 1.72% |
| Indica III | 913 | 81.60% | 1.30% | 0.00% | 0.00% | GA: 17.09% |
| Indica Intermediate | 786 | 87.50% | 6.20% | 0.00% | 0.00% | GA: 6.11%; GAA: 0.13% |
| Temperate Japonica | 767 | 98.30% | 0.90% | 0.39% | 0.00% | GA: 0.39% |
| Tropical Japonica | 504 | 58.90% | 39.90% | 0.40% | 0.00% | GA: 0.79% |
| Japonica Intermediate | 241 | 93.40% | 5.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 0.00% | GA: 1.04% |
| Intermediate | 90 | 90.00% | 7.80% | 0.00% | 0.00% | GA: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430916237 | G -> GAA | LOC_Os04g52040.1 | upstream_gene_variant ; 2536.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GAA | LOC_Os04g52040.4 | upstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GAA | LOC_Os04g52040.3 | upstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GAA | LOC_Os04g52060.1 | downstream_gene_variant ; 4316.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GAA | LOC_Os04g52050.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> A | LOC_Os04g52040.1 | upstream_gene_variant ; 2535.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> A | LOC_Os04g52040.4 | upstream_gene_variant ; 2584.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> A | LOC_Os04g52040.3 | upstream_gene_variant ; 2584.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> A | LOC_Os04g52060.1 | downstream_gene_variant ; 4317.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> A | LOC_Os04g52050.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GA | LOC_Os04g52040.1 | upstream_gene_variant ; 2536.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GA | LOC_Os04g52040.4 | upstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GA | LOC_Os04g52040.3 | upstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GA | LOC_Os04g52060.1 | downstream_gene_variant ; 4316.0bp to feature; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| vg0430916237 | G -> GA | LOC_Os04g52050.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.437; most accessible tissue: Callus, score: 89.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430916237 | NA | 5.31E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430916237 | 2.01E-06 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430916237 | NA | 9.60E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430916237 | 4.21E-11 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430916237 | 2.00E-06 | NA | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/