RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0430914321:

Variant ID: vg0430914321 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30914321
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACACAAGGTATAACCCTATAGAGAGTATGTTTGGGGGAGTTTCTAGCTGCTGCAACTTCTCCCATAACCAAAAGCTCCCTTAAATAGTCTATGTTTT[G/A]
GTACAGATTCTGAGAAGTTGTAGATATAGAATCCAGAAAATGAACTATAAGCTCGAAGGCAGAAGCTGAGAAACCCAACTTTTCTATATTCTCAGAAACT

Reverse complement sequence

AGTTTCTGAGAATATAGAAAAGTTGGGTTTCTCAGCTTCTGCCTTCGAGCTTATAGTTCATTTTCTGGATTCTATATCTACAACTTCTCAGAATCTGTAC[C/T]
AAAACATAGACTATTTAAGGGAGCTTTTGGTTATGGGAGAAGTTGCAGCAGCTAGAAACTCCCCCAAACATACTCTCTATAGGGTTATACCTTGTGTTTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	7.00%	0.06%	0.00%	NA
All Indica	2759	97.30%	2.70%	0.04%	0.00%	NA
All Japonica	1512	85.20%	14.70%	0.13%	0.00%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	93.80%	6.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	59.70%	39.90%	0.40%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430914321	G -> A	LOC_Os04g52050.1	3_prime_UTR_variant ; 396.0bp to feature; MODIFIER	silent_mutation	Average:66.617; most accessible tissue: Callus, score: 86.441	N	N	N	N
vg0430914321	G -> A	LOC_Os04g52040.1	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:66.617; most accessible tissue: Callus, score: 86.441	N	N	N	N
vg0430914321	G -> A	LOC_Os04g52040.4	upstream_gene_variant ; 668.0bp to feature; MODIFIER	silent_mutation	Average:66.617; most accessible tissue: Callus, score: 86.441	N	N	N	N
vg0430914321	G -> A	LOC_Os04g52040.3	upstream_gene_variant ; 668.0bp to feature; MODIFIER	silent_mutation	Average:66.617; most accessible tissue: Callus, score: 86.441	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430914321	NA	5.31E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430914321	2.01E-06	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430914321	NA	9.60E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430914321	4.21E-11	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430914321	2.00E-06	NA	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0430914321:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact