\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430813005:

Variant ID: vg0430813005 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30813005
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTCATTGACATGGCAGCGGCGGACCGGGTTCTAGACCGGGCTGACATTGTTGTTCAAGACATGGAGGCGGGGGAGGTGTTGGCGTCACAGCCGCATTC[A/G]
CCGACGTTGGTTTTGCAAGCGCCGGGTGTGTGGTTCTCTCCGCAAGCGGTGCAAGCAGTGGAGCAACCAGGGGCCGACGTGGGAATCCCTACCCCGCTGG

Reverse complement sequence

CCAGCGGGGTAGGGATTCCCACGTCGGCCCCTGGTTGCTCCACTGCTTGCACCGCTTGCGGAGAGAACCACACACCCGGCGCTTGCAAAACCAACGTCGG[T/C]
GAATGCGGCTGTGACGCCAACACCTCCCCCGCCTCCATGTCTTGAACAACAATGTCAGCCCGGTCTAGAACCCGGTCCGCCGCTGCCATGTCAATGACCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 26.00% 4.15% 32.95% NA
All Indica  2759 27.60% 11.10% 6.74% 54.58% NA
All Japonica  1512 53.60% 45.30% 0.33% 0.79% NA
Aus  269 12.60% 78.10% 1.49% 7.81% NA
Indica I  595 3.70% 1.30% 3.70% 91.26% NA
Indica II  465 74.00% 3.90% 1.08% 21.08% NA
Indica III  913 18.60% 21.70% 13.25% 46.44% NA
Indica Intermediate  786 28.80% 10.30% 4.83% 56.11% NA
Temperate Japonica  767 70.10% 29.30% 0.26% 0.26% NA
Tropical Japonica  504 20.40% 77.80% 0.40% 1.39% NA
Japonica Intermediate  241 70.10% 28.20% 0.41% 1.24% NA
VI/Aromatic  96 90.60% 7.30% 0.00% 2.08% NA
Intermediate  90 57.80% 23.30% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430813005 A -> DEL LOC_Os04g51930.1 N frameshift_variant Average:59.087; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0430813005 A -> G LOC_Os04g51930.1 synonymous_variant ; p.Ser571Ser; LOW synonymous_codon Average:59.087; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430813005 A G 0.0 -0.01 0.0 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430813005 NA 2.06E-19 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0430813005 NA 3.26E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 1.07E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 4.87E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 6.81E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 3.50E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 1.28E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 1.27E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 5.47E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 8.33E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 7.64E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 7.50E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 6.93E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 3.33E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 3.11E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 4.52E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 4.08E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 9.69E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 2.72E-06 2.16E-11 mr1530_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 4.97E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 3.95E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 3.20E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 3.36E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 5.59E-07 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430813005 NA 4.66E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251