\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428528974:

Variant ID: vg0428528974 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 28528974
Reference Allele: ATAlternative Allele: A,TT,ACT
Primary Allele: ATSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCGTGGATGGTCGAGGCCACTTGCTATGGTGGTGCGTATGTCAGTCTGATTGAGATAGCAAATGTATGCAACGGAAACCATTATTATAGTCTCCATAT[AT/A,TT,ACT]
TTTTTTTATAAACCTATACCTGGAACTCTTCATCTTCATTAACTCGTCTTCCGAATATGTTATCATTAATTGTAATTTGATTGCTAGTATCTAATGTCCT

Reverse complement sequence

AGGACATTAGATACTAGCAATCAAATTACAATTAATGATAACATATTCGGAAGACGAGTTAATGAAGATGAAGAGTTCCAGGTATAGGTTTATAAAAAAA[AT/T,AA,AGT]
ATATGGAGACTATAATAATGGTTTCCGTTGCATACATTTGCTATCTCAATCAGACTGACATACGCACCACCATAGCAAGTGGCCTCGACCATCCACGGGA

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 7.50% 0.80% 0.00% A: 0.13%; ACT: 0.04%
All Indica  2759 98.70% 0.80% 0.25% 0.00% A: 0.18%; ACT: 0.07%
All Japonica  1512 80.40% 17.60% 1.98% 0.00% A: 0.07%
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.00% A: 0.34%
Indica II  465 97.40% 1.90% 0.43% 0.00% A: 0.22%
Indica III  913 99.80% 0.10% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 97.50% 1.70% 0.51% 0.00% ACT: 0.25%; A: 0.13%
Temperate Japonica  767 97.80% 1.00% 1.17% 0.00% NA
Tropical Japonica  504 52.20% 45.40% 2.18% 0.00% A: 0.20%
Japonica Intermediate  241 83.80% 12.00% 4.15% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0428528974 AT -> A LOC_Os04g47970.1 downstream_gene_variant ; 2937.0bp to feature; MODIFIER silent_mutation Average:73.124; most accessible tissue: Callus, score: 93.496 N N N N
vg0428528974 AT -> A LOC_Os04g47970-LOC_Os04g47990 intergenic_region ; MODIFIER silent_mutation Average:73.124; most accessible tissue: Callus, score: 93.496 N N N N
vg0428528974 AT -> ACT LOC_Os04g47970.1 downstream_gene_variant ; 2937.0bp to feature; MODIFIER silent_mutation Average:73.124; most accessible tissue: Callus, score: 93.496 N N N N
vg0428528974 AT -> ACT LOC_Os04g47970-LOC_Os04g47990 intergenic_region ; MODIFIER silent_mutation Average:73.124; most accessible tissue: Callus, score: 93.496 N N N N
vg0428528974 AT -> TT LOC_Os04g47970.1 downstream_gene_variant ; 2936.0bp to feature; MODIFIER silent_mutation Average:73.124; most accessible tissue: Callus, score: 93.496 N N N N
vg0428528974 AT -> TT LOC_Os04g47970-LOC_Os04g47990 intergenic_region ; MODIFIER silent_mutation Average:73.124; most accessible tissue: Callus, score: 93.496 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0428528974 AT A 0.06 0.07 0.04 -0.08 0.05 0.04
vg0428528974 AT ACT 0.09 -0.05 -0.11 -0.11 0.08 0.17
vg0428528974 AT TT 0.0 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0428528974 NA 8.18E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 NA 4.66E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 NA 7.63E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 NA 5.08E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 NA 4.18E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 NA 7.51E-08 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 3.03E-08 NA mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 1.14E-06 3.74E-09 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428528974 5.56E-07 NA mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251