Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425192355:

Variant ID: vg0425192355 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25192355
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GCGCCGGCGAGGAGGGCCTCGAGGGCGTCGATCGCGCCGTCGAGCCTGGCGGGCAGGGACTCGACGAGGAGGACGAGGTCGTCGGCGCCCCTGCCGAGGA[C/A]
GCGCTCGGCGGCCGGGAAGAGCACCGCGGCGACGTCCTGGACGACGAGGAGCTGCCTGTCCGCGAAGGCGAGCGCCGAGAGGCACCTCAGCCGCAGCGGG

Reverse complement sequence

CCCGCTGCGGCTGAGGTGCCTCTCGGCGCTCGCCTTCGCGGACAGGCAGCTCCTCGTCGTCCAGGACGTCGCCGCGGTGCTCTTCCCGGCCGCCGAGCGC[G/T]
TCCTCGGCAGGGGCGCCGACGACCTCGTCCTCCTCGTCGAGTCCCTGCCCGCCAGGCTCGACGGCGCGATCGACGCCCTCGAGGCCCTCCTCGCCGGCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.10%	0.63%	0.00%	NA
All Indica	2759	40.40%	58.60%	0.94%	0.00%	NA
All Japonica	1512	99.10%	0.70%	0.13%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	20.00%	79.00%	1.01%	0.00%	NA
Indica II	465	9.70%	89.20%	1.08%	0.00%	NA
Indica III	913	64.10%	35.60%	0.33%	0.00%	NA
Indica Intermediate	786	46.60%	51.90%	1.53%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	26.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425192355	C -> A	LOC_Os04g42590.1	missense_variant ; p.Val108Phe; MODERATE	nonsynonymous_codon ; V108F	Average:88.17; most accessible tissue: Minghui63 flag leaf, score: 97.346	unknown	unknown	DELETERIOUS	0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0425192355	C	A	-0.03	-0.03	-0.04	-0.02	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425192355	NA	4.88E-35	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	6.90E-36	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	8.27E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	2.11E-48	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	9.87E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	3.67E-16	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	1.33E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	1.16E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	8.62E-20	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425192355	NA	4.17E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251