Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425191598:

Variant ID: vg0425191598 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25191598
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTTTGAAATGTTTGCATGCTTCTATCTGCTGATATTTACATTTTTGAAGCAGTGAACAGCTCATGCGTTGTGATGTACCCAGGTTTTATTCTCTACA[A/C]
TCCGGTATGCGACAGTTCACAATATGACACTAGCAGTGCAAGGATTACTACAAGTCTACAACTTCACAACACTATACTATACAGTGTCCAATGGTTACAC

Reverse complement sequence

GTGTAACCATTGGACACTGTATAGTATAGTGTTGTGAAGTTGTAGACTTGTAGTAATCCTTGCACTGCTAGTGTCATATTGTGAACTGTCGCATACCGGA[T/G]
TGTAGAGAATAAAACCTGGGTACATCACAACGCATGAGCTGTTCACTGCTTCAAAAATGTAAATATCAGCAGATAGAAGCATGCAAACATTTCAAACCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 44.90% 0.13% 0.38% NA
All Indica  2759 87.10% 12.30% 0.18% 0.43% NA
All Japonica  1512 0.90% 98.90% 0.00% 0.20% NA
Aus  269 47.60% 52.40% 0.00% 0.00% NA
Indica I  595 80.70% 17.80% 0.34% 1.18% NA
Indica II  465 96.80% 2.60% 0.00% 0.65% NA
Indica III  913 92.90% 6.90% 0.11% 0.11% NA
Indica Intermediate  786 79.40% 20.20% 0.25% 0.13% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 98.80% 0.00% 0.83% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 37.80% 57.80% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425191598 A -> C LOC_Os04g42580.1 3_prime_UTR_variant ; 404.0bp to feature; MODIFIER silent_mutation Average:88.058; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0425191598 A -> C LOC_Os04g42590.1 3_prime_UTR_variant ; 119.0bp to feature; MODIFIER silent_mutation Average:88.058; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0425191598 A -> C LOC_Os04g42570.1 downstream_gene_variant ; 4923.0bp to feature; MODIFIER silent_mutation Average:88.058; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0425191598 A -> C LOC_Os04g42600.1 downstream_gene_variant ; 2427.0bp to feature; MODIFIER silent_mutation Average:88.058; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0425191598 A -> C LOC_Os04g42600.2 downstream_gene_variant ; 3192.0bp to feature; MODIFIER silent_mutation Average:88.058; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0425191598 A -> DEL N N silent_mutation Average:88.058; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0425191598 A C 0.03 0.02 0.01 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425191598 NA 3.80E-07 mr1873 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 2.48E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 4.66E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 3.42E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 1.31E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 2.81E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 1.74E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 6.94E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 7.14E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 1.84E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 3.12E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 6.68E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 1.07E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 4.76E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 3.70E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 2.02E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425191598 NA 1.74E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251