Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0424939176:

Variant ID: vg0424939176 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24939176
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGACCGTACCGATACCGTTTCCGCAAAACTAATATAATAATAATATTTTTATCGATGGTTATCATTTTTAAAATTTAGTTTTTTTTAATTTCTAACGG[T/C]
GTGGCATTGAAGTTGACACTAAATAGATGAATTCATGAATATGAAAATTTTTCGACCGTTTCTGCTTGTTTTTTAAAAAATAATAAAATAATGATGCCGT

Reverse complement sequence

ACGGCATCATTATTTTATTATTTTTTAAAAAACAAGCAGAAACGGTCGAAAAATTTTCATATTCATGAATTCATCTATTTAGTGTCAACTTCAATGCCAC[A/G]
CCGTTAGAAATTAAAAAAAACTAAATTTTAAAAATGATAACCATCGATAAAAATATTATTATTATATTAGTTTTGCGGAAACGGTATCGGTACGGTCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele)Frequency of T(secondary allele)Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.90% 11.10% 11.07% 50.00% NA
All Indica  2759 7.10% 0.40% 8.41% 84.05% NA
All Japonica  1512 57.10% 32.30% 9.92% 0.73% NA
Aus  269 49.80% 0.70% 48.33% 1.12% NA
Indica I  595 10.40% 0.50% 10.08% 78.99% NA
Indica II  465 3.20% 0.20% 3.23% 93.33% NA
Indica III  913 2.80% 0.10% 9.09% 87.95% NA
Indica Intermediate  786 12.00% 0.80% 9.41% 77.86% NA
Temperate Japonica  767 25.90% 59.70% 14.21% 0.13% NA
Tropical Japonica  504 93.70% 0.60% 3.97% 1.79% NA
Japonica Intermediate  241 79.70% 11.20% 8.71% 0.41% NA
VI/Aromatic  96 85.40% 11.50% 1.04% 2.08% NA
Intermediate  90 45.60% 12.20% 11.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424939176 T -> C LOC_Os04g42120.1 upstream_gene_variant ; 394.0bp to feature; MODIFIER silent_mutation Average:13.156; most accessible tissue: Callus, score: 76.217 N N N N
vg0424939176 T -> C LOC_Os04g42130.1 upstream_gene_variant ; 1285.0bp to feature; MODIFIER silent_mutation Average:13.156; most accessible tissue: Callus, score: 76.217 N N N N
vg0424939176 T -> C LOC_Os04g42110.1 downstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:13.156; most accessible tissue: Callus, score: 76.217 N N N N
vg0424939176 T -> C LOC_Os04g42134.1 downstream_gene_variant ; 3945.0bp to feature; MODIFIER silent_mutation Average:13.156; most accessible tissue: Callus, score: 76.217 N N N N
vg0424939176 T -> C LOC_Os04g42120-LOC_Os04g42130 intergenic_region ; MODIFIER silent_mutation Average:13.156; most accessible tissue: Callus, score: 76.217 N N N N
vg0424939176 T -> DEL N N silent_mutation Average:13.156; most accessible tissue: Callus, score: 76.217 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424939176 NA 7.19E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424939176 NA 6.58E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424939176 NA 1.08E-06 mr1003 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.13E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 9.05E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.01E-06 mr1051 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.01E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 7.17E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 9.35E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 7.79E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 8.67E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.27E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 4.88E-08 mr1205 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.01E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.53E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 9.69E-09 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.57E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.35E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.60E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 4.76E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.93E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.29E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.59E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.91E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.51E-06 mr1685 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.88E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.42E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.27E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.39E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 1.05E-06 1.43E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.77E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.39E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.26E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.15E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.94E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.68E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.29E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.47E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 3.01E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 4.25E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 6.04E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.21E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.13E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.34E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.49E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.14E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 1.85E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 2.77E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424939176 NA 5.29E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251