Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424844822:

Variant ID: vg0424844822 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 24844822
Reference Allele: GACCGCGCAlternative Allele: G,GCGACACCGCGC
Primary Allele: GACCGCGCSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGCGAGGGCGCAGGAGTACTGGGAGCGCGCCATCGTCGCCAACCCCGGCGACGGCGACGCCCTCGCGCTCTACGCGGGCCTCGTCTGGGAGACCACCC[GACCGCGC/G,GCGACACCGCGC]
CGACGCCTACTTCACCTGAGGAAGGGGCCCCGCCACCGCTCGCCCGCCGCCGCCAAGCCAACTGCTAGACGTTGCCGCATACAAGCACGCCGCCGCCGGC

Reverse complement sequence

GCCGGCGGCGGCGTGCTTGTATGCGGCAACGTCTAGCAGTTGGCTTGGCGGCGGCGGGCGAGCGGTGGCGGGGCCCCTTCCTCAGGTGAAGTAGGCGTCG[GCGCGGTC/C,GCGCGGTGTCGC]
GGGTGGTCTCCCAGACGAGGCCCGCGTAGAGCGCGAGGGCGTCGCCGTCGCCGGGGTTGGCGACGATGGCGCGCTCCCAGTACTCCTGCGCCCTCGCCGC

Allele Frequencies:

Populations Population SizeFrequency of GACCGCGC(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 1.60% 1.21% 0.00% GCGACACCGCGC: 0.04%
All Indica  2759 96.60% 1.90% 1.49% 0.00% GCGACACCGCGC: 0.04%
All Japonica  1512 98.30% 1.00% 0.73% 0.00% NA
Aus  269 95.50% 2.20% 1.86% 0.00% GCGACACCGCGC: 0.37%
Indica I  595 96.00% 1.00% 3.03% 0.00% NA
Indica II  465 97.00% 1.50% 1.51% 0.00% NA
Indica III  913 96.90% 2.50% 0.55% 0.00% NA
Indica Intermediate  786 96.40% 2.00% 1.40% 0.00% GCGACACCGCGC: 0.13%
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 1.80% 1.79% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424844822 GACCGCGC -> GCGACACCGCGC LOC_Os04g41930.1 frameshift_variant ; p.Pro136fs; HIGH frameshift_variant Average:93.979; most accessible tissue: Zhenshan97 flag leaf, score: 98.936 N N N N
vg0424844822 GACCGCGC -> G LOC_Os04g41930.1 frameshift_variant ; p.Pro136fs; HIGH frameshift_variant Average:93.979; most accessible tissue: Zhenshan97 flag leaf, score: 98.936 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424844822 GACCG* G -0.02 -0.01 -0.07 -0.05 -0.05 -0.06
vg0424844822 GACCG* GCGAC* -0.06 -0.04 -0.06 -0.04 -0.06 -0.05