Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424844819:

Variant ID: vg0424844819 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 24844819
Reference Allele: CAlternative Allele: CCCGCGACG,CCCGCGACA
Primary Allele: CCCGCGACGSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGCGGCGAGGGCGCAGGAGTACTGGGAGCGCGCCATCGTCGCCAACCCCGGCGACGGCGACGCCCTCGCGCTCTACGCGGGCCTCGTCTGGGAGACCA[C/CCCGCGACG,CCCGCGACA]
CCGACCGCGCCGACGCCTACTTCACCTGAGGAAGGGGCCCCGCCACCGCTCGCCCGCCGCCGCCAAGCCAACTGCTAGACGTTGCCGCATACAAGCACGC

Reverse complement sequence

GCGTGCTTGTATGCGGCAACGTCTAGCAGTTGGCTTGGCGGCGGCGGGCGAGCGGTGGCGGGGCCCCTTCCTCAGGTGAAGTAGGCGTCGGCGCGGTCGG[G/CGTCGCGGG,TGTCGCGGG]
TGGTCTCCCAGACGAGGCCCGCGTAGAGCGCGAGGGCGTCGCCGTCGCCGGGGTTGGCGACGATGGCGCGCTCCCAGTACTCCTGCGCCCTCGCCGCGTC

Allele Frequencies:

Populations Population SizeFrequency of CCCGCGACG(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 16.60% 16.84% 0.00% CCCGCGACA: 5.21%
All Indica  2759 70.50% 4.60% 19.75% 0.00% CCCGCGACA: 5.15%
All Japonica  1512 46.80% 41.30% 11.90% 0.00% NA
Aus  269 51.70% 1.10% 11.90% 0.00% CCCGCGACA: 35.32%
Indica I  595 78.70% 2.20% 18.99% 0.00% CCCGCGACA: 0.17%
Indica II  465 68.40% 4.50% 26.67% 0.00% CCCGCGACA: 0.43%
Indica III  913 68.30% 5.60% 15.88% 0.00% CCCGCGACA: 10.19%
Indica Intermediate  786 68.20% 5.20% 20.74% 0.00% CCCGCGACA: 5.85%
Temperate Japonica  767 22.90% 71.70% 5.35% 0.00% NA
Tropical Japonica  504 70.60% 4.40% 25.00% 0.00% NA
Japonica Intermediate  241 72.60% 22.00% 5.39% 0.00% NA
VI/Aromatic  96 57.30% 14.60% 26.04% 0.00% CCCGCGACA: 2.08%
Intermediate  90 60.00% 16.70% 15.56% 0.00% CCCGCGACA: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424844819 C -> CCCGCGACA LOC_Os04g41930.1 frameshift_variant ; p.Pro136fs; HIGH frameshift_variant Average:93.987; most accessible tissue: Zhenshan97 flag leaf, score: 98.936 N N N N
vg0424844819 C -> CCCGCGACG LOC_Os04g41930.1 frameshift_variant ; p.Pro136fs; HIGH frameshift_variant Average:93.987; most accessible tissue: Zhenshan97 flag leaf, score: 98.936 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424844819 C CCCGC* -0.04 -0.06 -0.04 -0.05 -0.05 -0.06