Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424742142:

Variant ID: vg0424742142 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24742142
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTGCCGCCCATGGACGAGGACGACTACTCGCCGCTGTCCCCGTGGACGATCCTGTCGACCACCAAGTCCGTCAAGTACATCGACGCGGCGCACTACGC[T/G]
GTGCCGGGCGGCGCCCGCGCGGTTGAGCTGGTGTCCGGCATGGAGACGGCGATGCTGCAGGAGGTGAGCACCGTGCCCGGGCGGTCGTACAGGCTGGAGT

Reverse complement sequence

ACTCCAGCCTGTACGACCGCCCGGGCACGGTGCTCACCTCCTGCAGCATCGCCGTCTCCATGCCGGACACCAGCTCAACCGCGCGGGCGCCGCCCGGCAC[A/C]
GCGTAGTGCGCCGCGTCGATGTACTTGACGGACTTGGTGGTCGACAGGATCGTCCACGGGGACAGCGGCGAGTAGTCGTCCTCGTCCATGGGCGGCACAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	0.10%	11.32%	33.01%	NA
All Indica	2759	26.20%	0.20%	18.19%	55.45%	NA
All Japonica	1512	99.10%	0.00%	0.40%	0.46%	NA
Aus	269	85.90%	0.40%	8.55%	5.20%	NA
Indica I	595	27.60%	0.50%	28.07%	43.87%	NA
Indica II	465	26.20%	0.40%	15.48%	57.85%	NA
Indica III	913	19.30%	0.00%	14.57%	66.16%	NA
Indica Intermediate	786	33.10%	0.00%	16.54%	50.38%	NA
Temperate Japonica	767	99.30%	0.00%	0.13%	0.52%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	97.50%	0.00%	1.66%	0.83%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	85.60%	1.10%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424742142	T -> DEL	LOC_Os04g41740.1	N	frameshift_variant	Average:88.121; most accessible tissue: Zhenshan97 panicle, score: 99.146	N	N	N	N
vg0424742142	T -> G	LOC_Os04g41740.1	synonymous_variant ; p.Ala257Ala; LOW	synonymous_codon	Average:88.121; most accessible tissue: Zhenshan97 panicle, score: 99.146	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0424742142	T	G	0.05	0.02	0.03	-0.02	0.01	0.0