Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424741072:

Variant ID: vg0424741072 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24741072
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTGACAGCATATCACAATCTCCTGTACAGTTCTAAACCTGTTTGCTGTCCAATCCCATTGCCACCTTGCTTACAACCAAGTAATAACAGGAGCAGTAC[T/C]
TGCTCAGAGAGGTGATGAGAAGAAAAACAGAGATGATTCAGACTACCCCCTGCGTCGCGCTGCTCTTGCTCGTCGGCGTTGCTTTTGCTGCTCGATCGGC

Reverse complement sequence

GCCGATCGAGCAGCAAAAGCAACGCCGACGAGCAAGAGCAGCGCGACGCAGGGGGTAGTCTGAATCATCTCTGTTTTTCTTCTCATCACCTCTCTGAGCA[A/G]
GTACTGCTCCTGTTATTACTTGGTTGTAAGCAAGGTGGCAATGGGATTGGACAGCAAACAGGTTTAGAACTGTACAGGAGATTGTGATATGCTGTCACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	39.50%	0.00%	0.66%	NA
All Indica	2759	96.10%	3.10%	0.00%	0.76%	NA
All Japonica	1512	0.70%	98.90%	0.00%	0.33%	NA
Aus	269	46.80%	53.20%	0.00%	0.00%	NA
Indica I	595	95.60%	3.00%	0.00%	1.34%	NA
Indica II	465	96.60%	2.60%	0.00%	0.86%	NA
Indica III	913	98.50%	1.20%	0.00%	0.33%	NA
Indica Intermediate	786	93.50%	5.70%	0.00%	0.76%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	1.60%	98.00%	0.00%	0.40%	NA
Japonica Intermediate	241	0.40%	98.80%	0.00%	0.83%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	43.30%	51.10%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424741072	T -> C	LOC_Os04g41740.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:79.964; most accessible tissue: Callus, score: 92.469	N	N	N	N
vg0424741072	T -> C	LOC_Os04g41740.1	5_prime_UTR_variant ; 15.0bp to feature; MODIFIER	silent_mutation	Average:79.964; most accessible tissue: Callus, score: 92.469	N	N	N	N
vg0424741072	T -> C	LOC_Os04g41730.1	upstream_gene_variant ; 3076.0bp to feature; MODIFIER	silent_mutation	Average:79.964; most accessible tissue: Callus, score: 92.469	N	N	N	N
vg0424741072	T -> C	LOC_Os04g41750.1	upstream_gene_variant ; 3625.0bp to feature; MODIFIER	silent_mutation	Average:79.964; most accessible tissue: Callus, score: 92.469	N	N	N	N
vg0424741072	T -> DEL	N	N	silent_mutation	Average:79.964; most accessible tissue: Callus, score: 92.469	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0424741072	T	C	0.01	0.0	0.01	0.02	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424741072	NA	1.38E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	6.58E-42	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	7.02E-24	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	9.52E-22	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	1.20E-24	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	5.54E-19	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	5.87E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	3.03E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	2.97E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	3.32E-30	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	4.41E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	2.34E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	2.69E-19	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424741072	NA	4.35E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251