RiceVarMap2

Detailed information for vg0421623781:

Variant ID: vg0421623781 (JBrowse)

Variation Type: SNP

Chromosome: chr04

Position: 21623781

Reference Allele: A

Alternative Allele: G

Primary Allele: A

Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CGTATTTTTCTGCATAGACCTGAATGTGCGGTGAATTCTCAGACAGTTAGTTCAATAATTATTTCAATTTTCAAATGATCCTGACATATCCTAGTACGAG[A/G]
TTGGTTTATTTCGGGAAGTGAGAGTACAGTTTAAGCATTATTCACCTTGAATGTTGGGTCCTCAAATAATGCAGCATCTGTAGGCAAGACCAGGAGATCC

Reverse complement sequence

GGATCTCCTGGTCTTGCCTACAGATGCTGCATTATTTGAGGACCCAACATTCAAGGTGAATAATGCTTAAACTGTACTCTCACTTCCCGAAATAAACCAA[T/C]
CTCGTACTAGGATATGTCAGGATCATTTGAAAATTGAAATAATTATTGAACTAACTGTCTGAGAATTCACCGCACATTCAGGTCTATGCAGAAAAATACG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	38.60%	0.23%	0.42%	NA
All Indica	2759	37.70%	61.30%	0.36%	0.65%	NA
All Japonica	1512	97.80%	2.10%	0.07%	0.07%	NA
Aus	269	76.20%	23.80%	0.00%	0.00%	NA
Indica I	595	28.20%	70.90%	0.34%	0.50%	NA
Indica II	465	10.10%	89.20%	0.22%	0.43%	NA
Indica III	913	49.90%	49.50%	0.11%	0.44%	NA
Indica Intermediate	786	46.90%	51.10%	0.76%	1.15%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	94.20%	5.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	0.00%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421623781	A -> DEL	N	N	silent_mutation	Average:67.365; most accessible tissue: Callus, score: 85.708	N	N	N	N
vg0421623781	A -> G	LOC_Os04g35520.1	intron_variant ; MODIFIER	silent_mutation	Average:67.365; most accessible tissue: Callus, score: 85.708	N	N	N	N
vg0421623781	A -> G	LOC_Os04g35520.2	intron_variant ; MODIFIER	silent_mutation	Average:67.365; most accessible tissue: Callus, score: 85.708	N	N	N	N
vg0421623781	A -> G	LOC_Os04g35520.3	intron_variant ; MODIFIER	silent_mutation	Average:67.365; most accessible tissue: Callus, score: 85.708	N	N	N	N
vg0421623781	A -> G	LOC_Os04g35520.4	intron_variant ; MODIFIER	silent_mutation	Average:67.365; most accessible tissue: Callus, score: 85.708	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421623781	NA	7.39E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0421623781:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact