| Variant ID: vg0421387824 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21387824 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATCAATTTAAAATTATCTATTTTTTAATACATGATTTTATTTAAAATTATCATTCACATAATTCTAATAATTTTATAGTTTTTAAAAGGTACGCCAGTCG[C/G]
TACCCCTTCCTCGGGAGCGCCTACGGATCGGGCGATCGATTCGGGGCTGAGAAATCGGGCGCGTCCGATTTACGTGCAAAACTATTTTAAACCGATTTTT
AAAAATCGGTTTAAAATAGTTTTGCACGTAAATCGGACGCGCCCGATTTCTCAGCCCCGAATCGATCGCCCGATCCGTAGGCGCTCCCGAGGAAGGGGTA[G/C]
CGACTGGCGTACCTTTTAAAAACTATAAAATTATTAGAATTATGTGAATGATAATTTTAAATAAAATCATGTATTAAAAAATAGATAATTTTAAATTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 2.30% | 0.28% | 13.37% | NA |
| All Indica | 2759 | 80.40% | 0.10% | 0.36% | 19.14% | NA |
| All Japonica | 1512 | 89.30% | 5.10% | 0.13% | 5.49% | NA |
| Aus | 269 | 95.20% | 0.00% | 0.37% | 4.46% | NA |
| Indica I | 595 | 85.40% | 0.00% | 0.34% | 14.29% | NA |
| Indica II | 465 | 80.40% | 0.00% | 0.00% | 19.57% | NA |
| Indica III | 913 | 75.50% | 0.20% | 0.55% | 23.77% | NA |
| Indica Intermediate | 786 | 82.20% | 0.30% | 0.38% | 17.18% | NA |
| Temperate Japonica | 767 | 97.30% | 1.20% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 92.90% | 4.40% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 56.40% | 19.10% | 0.00% | 24.48% | NA |
| VI/Aromatic | 96 | 70.80% | 26.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 87.80% | 5.60% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421387824 | C -> DEL | N | N | silent_mutation | Average:62.553; most accessible tissue: Callus, score: 88.987 | N | N | N | N |
| vg0421387824 | C -> G | LOC_Os04g35200.1 | upstream_gene_variant ; 232.0bp to feature; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Callus, score: 88.987 | N | N | N | N |
| vg0421387824 | C -> G | LOC_Os04g35190.1 | downstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Callus, score: 88.987 | N | N | N | N |
| vg0421387824 | C -> G | LOC_Os04g35200-LOC_Os04g35210 | intergenic_region ; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Callus, score: 88.987 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421387824 | 1.59E-09 | 3.70E-11 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 3.96E-10 | 2.38E-13 | mr1114 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 2.17E-07 | 4.72E-09 | mr1116 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 3.74E-11 | 1.28E-15 | mr1117 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 4.72E-08 | 1.04E-13 | mr1118 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 4.04E-11 | 4.07E-13 | mr1119 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 1.81E-10 | 1.24E-12 | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | 6.15E-12 | 5.56E-17 | mr1123 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | NA | 9.58E-06 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421387824 | NA | 7.93E-07 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/