\
| Variant ID: vg0420830218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20830218 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 65. )
AGTACATTTCACTTTTGGCATCTGCCCACCGCACAATATGTCTCATTTACTTGGTAGTTGGCTAAGTGGTGTTAACATTAGGCTAAAAAATCAAGTTTTT[G/A]
TGGGCATAGCGGCGTTGTGCTGGGCGGTGTGGTTAAATAGGAATGATGTGGTTTTTAATGGACCATGTACTTACTCTTTTATGCAGGTAATTTTCAGAGG
CCTCTGAAAATTACCTGCATAAAAGAGTAAGTACATGGTCCATTAAAAACCACATCATTCCTATTTAACCACACCGCCCAGCACAACGCCGCTATGCCCA[C/T]
AAAAACTTGATTTTTTAGCCTAATGTTAACACCACTTAGCCAACTACCAAGTAAATGAGACATATTGTGCGGTGGGCAGATGCCAAAAGTGAAATGTACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.20% | 21.20% | 22.85% | 24.80% | NA |
| All Indica | 2759 | 7.20% | 33.80% | 35.70% | 23.27% | NA |
| All Japonica | 1512 | 64.60% | 1.30% | 3.64% | 30.56% | NA |
| Aus | 269 | 75.80% | 6.30% | 3.72% | 14.13% | NA |
| Indica I | 595 | 0.50% | 31.80% | 49.58% | 18.15% | NA |
| Indica II | 465 | 5.20% | 13.10% | 33.33% | 48.39% | NA |
| Indica III | 913 | 8.40% | 48.60% | 27.71% | 15.22% | NA |
| Indica Intermediate | 786 | 12.10% | 30.40% | 35.88% | 21.63% | NA |
| Temperate Japonica | 767 | 82.30% | 0.30% | 1.04% | 16.43% | NA |
| Tropical Japonica | 504 | 36.30% | 3.00% | 8.13% | 52.58% | NA |
| Japonica Intermediate | 241 | 67.20% | 0.80% | 2.49% | 29.46% | NA |
| VI/Aromatic | 96 | 54.20% | 18.80% | 16.67% | 10.42% | NA |
| Intermediate | 90 | 47.80% | 14.40% | 15.56% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420830218 | G -> DEL | N | N | silent_mutation | Average:13.744; most accessible tissue: Callus, score: 36.586 | N | N | N | N |
| vg0420830218 | G -> A | LOC_Os04g34410.1 | upstream_gene_variant ; 4367.0bp to feature; MODIFIER | silent_mutation | Average:13.744; most accessible tissue: Callus, score: 36.586 | N | N | N | N |
| vg0420830218 | G -> A | LOC_Os04g34390.1 | downstream_gene_variant ; 2507.0bp to feature; MODIFIER | silent_mutation | Average:13.744; most accessible tissue: Callus, score: 36.586 | N | N | N | N |
| vg0420830218 | G -> A | LOC_Os04g34400.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.744; most accessible tissue: Callus, score: 36.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420830218 | NA | 4.15E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 7.51E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 6.30E-10 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 1.07E-06 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 1.52E-06 | NA | mr1059 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 1.47E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 1.78E-06 | NA | mr1143 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 8.08E-06 | 1.77E-09 | mr1162 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 7.98E-07 | NA | mr1167 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 7.79E-07 | NA | mr1185 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 2.11E-06 | NA | mr1193 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 7.15E-07 | 7.14E-07 | mr1193 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 7.02E-06 | NA | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 1.08E-06 | 3.10E-07 | mr1311 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 1.82E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 9.63E-06 | NA | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 3.47E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 5.34E-07 | 5.44E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 1.17E-06 | NA | mr1426 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 2.92E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 2.36E-06 | NA | mr1439 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 5.76E-06 | NA | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 9.14E-07 | NA | mr1479 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 8.01E-06 | NA | mr1485 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 5.65E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 7.11E-06 | mr1513 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 9.82E-08 | NA | mr1535 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 6.56E-06 | NA | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 8.49E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 7.93E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 6.83E-06 | 9.66E-08 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 5.76E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 3.33E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 8.94E-11 | mr1630 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 1.86E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 6.31E-06 | NA | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 6.36E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 1.14E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 1.04E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 9.69E-06 | NA | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 6.13E-07 | mr1768 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 2.79E-09 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 4.96E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 3.51E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 4.46E-06 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 5.65E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | NA | 2.44E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420830218 | 1.81E-06 | NA | mr1975 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |