| Variant ID: vg0416574457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16574457 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )
CAGCGATGTCAAAGACATCGAGCACTCCTTTTCGCTGCCTTTTTTCTCTACTATTATCCACTCATGGTGCCATTTTGCCCATCTTCTTGTAGTTCATGTG[C/T]
AGTTCCGGTGATAAGTTAATCACCAGTTTGTGTTCTCTCACCTCCTCTCTTCCCTTCAGTGCATCGTTCGAGTCGATCTACGTATAACCATTGTCGTCAA
TTGACGACAATGGTTATACGTAGATCGACTCGAACGATGCACTGAAGGGAAGAGAGGAGGTGAGAGAACACAAACTGGTGATTAACTTATCACCGGAACT[G/A]
CACATGAACTACAAGAAGATGGGCAAAATGGCACCATGAGTGGATAATAGTAGAGAAAAAAGGCAGCGAAAAGGAGTGCTCGATGTCTTTGACATCGCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 5.10% | 2.67% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 8.40% | 2.86% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 0.20% | 2.98% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 87.60% | 4.70% | 7.73% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 85.10% | 14.20% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 7.80% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 0.00% | 5.08% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416574457 | C -> T | LOC_Os04g28060.1 | upstream_gene_variant ; 3410.0bp to feature; MODIFIER | silent_mutation | Average:44.282; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg0416574457 | C -> T | LOC_Os04g28074.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.282; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416574457 | 3.33E-06 | 1.63E-06 | mr1019_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 2.73E-09 | NA | mr1023_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 2.80E-07 | NA | mr1055_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 3.61E-07 | NA | mr1079_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 3.72E-07 | NA | mr1132_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 3.32E-07 | NA | mr1390_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 2.98E-10 | 2.73E-10 | mr1489_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 8.65E-06 | NA | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416574457 | 4.83E-06 | 4.83E-06 | mr1778_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |