Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416552855:

Variant ID: vg0416552855 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16552855
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TACATGTTTTCTCGCTAAGTAAAAGAAACTTTCAGTTGTTTCATCATTTGATAAAAAAATGTTACGGAGCTAACTAGGGATTGGACGATAAAATATTGGA[C/T]
GGTGATTCACCTTTTAGATGTTTTCTCATTACGGAGCTAACTAGGGATTGGACGATAAAATATTGGACTGTGATTCACATGTTAGATGTTTTCTCGCCCA

Reverse complement sequence

TGGGCGAGAAAACATCTAACATGTGAATCACAGTCCAATATTTTATCGTCCAATCCCTAGTTAGCTCCGTAATGAGAAAACATCTAAAAGGTGAATCACC[G/A]
TCCAATATTTTATCGTCCAATCCCTAGTTAGCTCCGTAACATTTTTTTATCAAATGATGAAACAACTGAAAGTTTCTTTTACTTAGCGAGAAAACATGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	35.70%	2.41%	7.24%	NA
All Indica	2759	29.90%	59.80%	3.15%	7.10%	NA
All Japonica	1512	98.10%	0.50%	0.99%	0.46%	NA
Aus	269	58.70%	0.40%	0.37%	40.52%	NA
Indica I	595	44.90%	40.00%	4.54%	10.59%	NA
Indica II	465	25.40%	68.20%	5.59%	0.86%	NA
Indica III	913	24.20%	65.30%	0.88%	9.64%	NA
Indica Intermediate	786	28.00%	63.50%	3.31%	5.22%	NA
Temperate Japonica	767	98.40%	0.10%	1.43%	0.00%	NA
Tropical Japonica	504	98.20%	0.60%	0.20%	0.99%	NA
Japonica Intermediate	241	96.70%	1.20%	1.24%	0.83%	NA
VI/Aromatic	96	70.80%	2.10%	3.12%	23.96%	NA
Intermediate	90	53.30%	30.00%	8.89%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416552855	C -> DEL	N	N	silent_mutation	Average:57.938; most accessible tissue: Callus, score: 76.973	N	N	N	N
vg0416552855	C -> T	LOC_Os04g28040.1	upstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:57.938; most accessible tissue: Callus, score: 76.973	N	N	N	N
vg0416552855	C -> T	LOC_Os04g28020.1	downstream_gene_variant ; 1987.0bp to feature; MODIFIER	silent_mutation	Average:57.938; most accessible tissue: Callus, score: 76.973	N	N	N	N
vg0416552855	C -> T	LOC_Os04g28030.1	downstream_gene_variant ; 697.0bp to feature; MODIFIER	silent_mutation	Average:57.938; most accessible tissue: Callus, score: 76.973	N	N	N	N
vg0416552855	C -> T	LOC_Os04g28030-LOC_Os04g28040	intergenic_region ; MODIFIER	silent_mutation	Average:57.938; most accessible tissue: Callus, score: 76.973	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416552855	NA	6.47E-11	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416552855	NA	2.09E-10	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251