| Variant ID: vg0414201150 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14201150 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 245. )
TGAACCATTTCACTTTGCTTCACACACTTGAAAGCTAATGGCCAGTACACCGAAAGGCCTTCAGAAGTTTAATCAATTGGAGCAATATACGACCAGGTTC[T/G,A]
ACAAATCGATCGTGTGGATGGGCGAAACTATGTCATTCTTATTGACACAAGGGGGTTGATTATTATATCAATTTTAAATAAGAAATAACCATAGATATAT
ATATATCTATGGTTATTTCTTATTTAAAATTGATATAATAATCAACCCCCTTGTGTCAATAAGAATGACATAGTTTCGCCCATCCACACGATCGATTTGT[A/C,T]
GAACCTGGTCGTATATTGCTCCAATTGATTAAACTTCTGAAGGCCTTTCGGTGTACTGGCCATTAGCTTTCAAGTGTGTGAAGCAAAGTGAAATGGTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 23.80% | 0.97% | 0.08% | A: 0.63% |
| All Indica | 2759 | 89.10% | 10.60% | 0.18% | 0.04% | A: 0.04% |
| All Japonica | 1512 | 44.20% | 53.00% | 2.65% | 0.13% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.00% | 34.50% | 0.34% | 0.17% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.00% | 7.50% | 0.38% | 0.00% | A: 0.13% |
| Temperate Japonica | 767 | 5.90% | 92.20% | 1.83% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 3.20% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 59.30% | 32.40% | 7.88% | 0.41% | NA |
| VI/Aromatic | 96 | 59.40% | 10.40% | 0.00% | 0.00% | A: 30.21% |
| Intermediate | 90 | 76.70% | 21.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414201150 | T -> A | LOC_Os04g24730.1 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:43.102; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0414201150 | T -> A | LOC_Os04g24730-LOC_Os04g24750 | intergenic_region ; MODIFIER | silent_mutation | Average:43.102; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0414201150 | T -> DEL | N | N | silent_mutation | Average:43.102; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0414201150 | T -> G | LOC_Os04g24730.1 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:43.102; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0414201150 | T -> G | LOC_Os04g24730-LOC_Os04g24750 | intergenic_region ; MODIFIER | silent_mutation | Average:43.102; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414201150 | 2.12E-06 | 4.40E-07 | mr1010 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 2.64E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 2.75E-08 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 9.51E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 7.50E-06 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 4.61E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 3.93E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | 2.11E-06 | 6.89E-11 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 3.34E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414201150 | NA | 9.25E-09 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/