Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412457585:

Variant ID: vg0412457585 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12457585
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGCACCAGCACAGTCAGTTCCATCCGCTCAAGCCAAGATGGAGGCTGGGACAAAGCCAGGGTCCTGCTTCAACTATGGCGAGCTTGGCCACTTCGCT[G/A]
ACAAATGCCCGAAGCCAAGGCGTGCCGGGCTAAGGTTTGTCCAGGCTCGTGTCAACCACGCGTCCGCAGAGGAGGCGCAAGCAGCACCAGAGGTCGTACT

Reverse complement sequence

AGTACGACCTCTGGTGCTGCTTGCGCCTCCTCTGCGGACGCGTGGTTGACACGAGCCTGGACAAACCTTAGCCCGGCACGCCTTGGCTTCGGGCATTTGT[C/T]
AGCGAAGTGGCCAAGCTCGCCATAGTTGAAGCAGGACCCTGGCTTTGTCCCAGCCTCCATCTTGGCTTGAGCGGATGGAACTGACTGTGCTGGTGCCATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	18.30%	7.26%	22.41%	NA
All Indica	2759	27.00%	30.80%	8.12%	34.03%	NA
All Japonica	1512	99.30%	0.00%	0.07%	0.60%	NA
Aus	269	23.00%	1.50%	40.89%	34.57%	NA
Indica I	595	51.80%	12.30%	5.71%	30.25%	NA
Indica II	465	27.50%	47.10%	5.81%	19.57%	NA
Indica III	913	7.70%	34.50%	11.72%	46.11%	NA
Indica Intermediate	786	30.50%	30.90%	7.12%	31.42%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.00%	0.41%	1.24%	NA
VI/Aromatic	96	95.80%	1.00%	1.04%	2.08%	NA
Intermediate	90	64.40%	10.00%	7.78%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412457585	G -> DEL	LOC_Os04g22000.1	N	frameshift_variant	Average:10.919; most accessible tissue: Callus, score: 26.727	N	N	N	N
vg0412457585	G -> A	LOC_Os04g22000.1	missense_variant ; p.Asp671Asn; MODERATE	nonsynonymous_codon ; D671N	Average:10.919; most accessible tissue: Callus, score: 26.727	benign	0.339	DELETERIOUS	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412457585	5.85E-08	7.59E-12	mr1053	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	8.03E-08	9.23E-08	mr1053	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	3.94E-06	NA	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	9.08E-07	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	6.76E-06	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	2.11E-06	1.76E-06	mr1128	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	6.68E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	3.09E-06	4.52E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	3.43E-06	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	9.40E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	5.31E-11	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	2.35E-09	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	9.64E-06	NA	mr1027_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	5.87E-07	1.47E-11	mr1027_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	9.71E-08	1.90E-10	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	2.79E-07	8.42E-08	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	1.14E-06	NA	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	2.82E-07	1.27E-13	mr1147_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	6.26E-07	8.12E-07	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	7.85E-06	NA	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	4.88E-06	7.69E-06	mr1204_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	4.67E-06	2.15E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	9.27E-06	9.27E-06	mr1250_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	3.48E-06	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	4.16E-06	3.13E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	1.58E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	6.55E-10	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412457585	NA	1.61E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251