\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409314108:

Variant ID: vg0409314108 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9314108
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, T: 0.43, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCGGATTTAATGCGTGACTCTCCATCCTCCACACAAGATTGGCTACATGGGCATCTAGAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATGA[T/C]
TAGTAGCATGTTTAAATGAATGATAAGTAGAATTACTTATCCTTGGTCTGTGTGCCAAGATAAAATATGACAATCAAAAGTAGATAAAGGGAGTATATAA

Reverse complement sequence

TTATATACTCCCTTTATCTACTTTTGATTGTCATATTTTATCTTGGCACACAGACCAAGGATAAGTAATTCTACTTATCATTCATTTAAACATGCTACTA[A/G]
TCATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTCTAGATGCCCATGTAGCCAATCTTGTGTGGAGGATGGAGAGTCACGCATTAAATCCGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 20.20% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 38.60% 61.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 4.20% 95.80% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 6.00% 0.00% 0.00% NA
Japonica Intermediate  241 32.40% 67.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409314108 T -> C LOC_Os04g17010.1 upstream_gene_variant ; 844.0bp to feature; MODIFIER silent_mutation Average:19.965; most accessible tissue: Minghui63 root, score: 29.362 N N N N
vg0409314108 T -> C LOC_Os04g17010-LOC_Os04g17020 intergenic_region ; MODIFIER silent_mutation Average:19.965; most accessible tissue: Minghui63 root, score: 29.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409314108 NA 6.08E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 1.13E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 1.09E-14 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 2.62E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 3.15E-09 mr1715 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 6.46E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 8.31E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 6.12E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 4.07E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409314108 NA 2.66E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251