Variant ID: vg0409314108 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 9314108 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, T: 0.43, others allele: 0.00, population size: 108. )
TCTCGGATTTAATGCGTGACTCTCCATCCTCCACACAAGATTGGCTACATGGGCATCTAGAAATGTAAATATTAATGAATCGCTTGTTTACGAGGAATGA[T/C]
TAGTAGCATGTTTAAATGAATGATAAGTAGAATTACTTATCCTTGGTCTGTGTGCCAAGATAAAATATGACAATCAAAAGTAGATAAAGGGAGTATATAA
TTATATACTCCCTTTATCTACTTTTGATTGTCATATTTTATCTTGGCACACAGACCAAGGATAAGTAATTCTACTTATCATTCATTTAAACATGCTACTA[A/G]
TCATTCCTCGTAAACAAGCGATTCATTAATATTTACATTTCTAGATGCCCATGTAGCCAATCTTGTGTGGAGGATGGAGAGTCACGCATTAAATCCGAGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 38.60% | 61.40% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 32.40% | 67.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0409314108 | T -> C | LOC_Os04g17010.1 | upstream_gene_variant ; 844.0bp to feature; MODIFIER | silent_mutation | Average:19.965; most accessible tissue: Minghui63 root, score: 29.362 | N | N | N | N |
vg0409314108 | T -> C | LOC_Os04g17010-LOC_Os04g17020 | intergenic_region ; MODIFIER | silent_mutation | Average:19.965; most accessible tissue: Minghui63 root, score: 29.362 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0409314108 | NA | 6.08E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 1.13E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 1.09E-14 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 2.62E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 3.15E-09 | mr1715 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 6.46E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 8.31E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 6.12E-30 | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 4.07E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409314108 | NA | 2.66E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |