\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406886096:

Variant ID: vg0406886096 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6886096
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCTTCTGAGCTGAAGCCGAAGTTAGAAGACCAAGGCTCAGACCCCAGTTGAGTTTTGCCTGTGGAGTGGAGCTGAAGCCCCGCTAGGATCGCCTTTTT[T/C]
CGCTGCTGTCGTTCTCTTTCGGTGTGAGGACTAAGTGCCTCTTCTGTAAGTATTTTACGCTTTATTTACGTTTGGAACTGTATATTACTTGTCGTTTTGT

Reverse complement sequence

ACAAAACGACAAGTAATATACAGTTCCAAACGTAAATAAAGCGTAAAATACTTACAGAAGAGGCACTTAGTCCTCACACCGAAAGAGAACGACAGCAGCG[A/G]
AAAAAGGCGATCCTAGCGGGGCTTCAGCTCCACTCCACAGGCAAAACTCAACTGGGGTCTGAGCCTTGGTCTTCTAACTTCGGCTTCAGCTCAGAAGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 16.70% 6.24% 39.02% NA
All Indica  2759 7.50% 24.10% 8.92% 59.48% NA
All Japonica  1512 94.80% 4.40% 0.26% 0.53% NA
Aus  269 30.90% 2.60% 14.87% 51.67% NA
Indica I  595 5.90% 6.70% 9.24% 78.15% NA
Indica II  465 9.50% 17.60% 9.25% 63.66% NA
Indica III  913 6.70% 37.10% 8.54% 47.65% NA
Indica Intermediate  786 8.70% 25.80% 8.91% 56.62% NA
Temperate Japonica  767 96.10% 3.40% 0.52% 0.00% NA
Tropical Japonica  504 94.80% 4.40% 0.00% 0.79% NA
Japonica Intermediate  241 90.90% 7.50% 0.00% 1.66% NA
VI/Aromatic  96 30.20% 36.50% 2.08% 31.25% NA
Intermediate  90 50.00% 17.80% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406886096 T -> C LOC_Os04g12460.1 downstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:28.559; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0406886096 T -> C LOC_Os04g12450-LOC_Os04g12460 intergenic_region ; MODIFIER silent_mutation Average:28.559; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0406886096 T -> DEL N N silent_mutation Average:28.559; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406886096 NA 5.17E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 3.30E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 8.08E-06 mr1189 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 1.82E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 2.10E-07 3.01E-06 mr1311 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 1.70E-06 1.70E-06 mr1311 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 2.93E-06 mr1314 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 3.76E-06 3.76E-06 mr1367 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 2.78E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 1.75E-07 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 3.70E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 5.46E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 3.33E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 6.14E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 8.17E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 5.86E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 9.65E-06 5.77E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 1.93E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 2.87E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 5.58E-07 3.00E-09 mr1866 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 1.70E-07 1.70E-07 mr1866 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 2.22E-12 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 5.44E-06 8.21E-07 mr1915 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 4.52E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406886096 NA 1.22E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251