\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406864964:

Variant ID: vg0406864964 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6864964
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTGTGAGGGCTGCTGGTCACATTGGATATTTTTGTGCCCTTGGCTTGCTCTTGTTGAGATTCACTTTTGAGCCTTACCTTCTTGTTTCCCCTCTCACC[C/T]
ATGTTCGATTCGGATTTGGTGTGTGTGTGAGAGTTGTGGATTCGAGTTTGTGTGAGTGCTTGTTGCTGACTTCGTGAAGATTTGTGAGCACTTGCATCAT

Reverse complement sequence

ATGATGCAAGTGCTCACAAATCTTCACGAAGTCAGCAACAAGCACTCACACAAACTCGAATCCACAACTCTCACACACACACCAAATCCGAATCGAACAT[G/A]
GGTGAGAGGGGAAACAAGAAGGTAAGGCTCAAAAGTGAATCTCAACAAGAGCAAGCCAAGGGCACAAAAATATCCAATGTGACCAGCAGCCCTCACAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 11.50% 0.61% 11.19% NA
All Indica  2759 64.70% 19.20% 0.94% 15.15% NA
All Japonica  1512 99.20% 0.30% 0.00% 0.46% NA
Aus  269 72.90% 0.00% 0.74% 26.39% NA
Indica I  595 77.10% 6.10% 0.67% 16.13% NA
Indica II  465 70.80% 15.90% 0.86% 12.47% NA
Indica III  913 57.30% 25.70% 0.55% 16.43% NA
Indica Intermediate  786 60.40% 23.40% 1.65% 14.50% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 71.90% 0.00% 1.04% 27.08% NA
Intermediate  90 82.20% 10.00% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406864964 C -> DEL N N silent_mutation Average:19.317; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0406864964 C -> T LOC_Os04g12430.1 upstream_gene_variant ; 4698.0bp to feature; MODIFIER silent_mutation Average:19.317; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0406864964 C -> T LOC_Os04g12420.1 downstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:19.317; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0406864964 C -> T LOC_Os04g12420-LOC_Os04g12430 intergenic_region ; MODIFIER silent_mutation Average:19.317; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406864964 NA 6.98E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 8.13E-06 NA mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 2.82E-06 2.82E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 7.15E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 8.94E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 9.11E-06 1.99E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 6.59E-06 6.59E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 4.58E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 8.32E-06 7.73E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 4.14E-06 4.14E-06 mr1474 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 8.32E-06 7.73E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 4.14E-06 4.14E-06 mr1475 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 1.46E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 1.49E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 3.12E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 6.58E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 5.66E-06 5.20E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 4.98E-06 4.98E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 1.02E-06 mr1730 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 4.02E-06 5.41E-06 mr1777 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 5.06E-07 5.06E-07 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406864964 NA 7.28E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251