\
| Variant ID: vg0406740172 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6740172 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGACATTGTTAAATTTAATTTTATTAAAGTCTCCATGATTAGTTACGCTCTTTAGAATTTTATTGGAATTTTCAGAGCTTAATTGCTAATTTTAATAAT[A/G]
CAAACATCATTTAATAATTATTTAATTGGAAAAAGAAAGAAAATACTTCCTTTTAGGTTTGCTTAGAAATAAACACATTCAATACTATAATTGTAAATGC
GCATTTACAATTATAGTATTGAATGTGTTTATTTCTAAGCAAACCTAAAAGGAAGTATTTTCTTTCTTTTTCCAATTAAATAATTATTAAATGATGTTTG[T/C]
ATTATTAAAATTAGCAATTAAGCTCTGAAAATTCCAATAAAATTCTAAAGAGCGTAACTAATCATGGAGACTTTAATAAAATTAAATTTAACAATGTCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 38.00% | 6.69% | 5.71% | NA |
| All Indica | 2759 | 27.10% | 56.00% | 10.47% | 6.42% | NA |
| All Japonica | 1512 | 95.00% | 1.40% | 0.40% | 3.17% | NA |
| Aus | 269 | 25.70% | 69.50% | 4.46% | 0.37% | NA |
| Indica I | 595 | 51.90% | 37.50% | 6.72% | 3.87% | NA |
| Indica II | 465 | 27.30% | 52.90% | 11.40% | 8.39% | NA |
| Indica III | 913 | 13.10% | 70.10% | 11.61% | 5.15% | NA |
| Indica Intermediate | 786 | 24.60% | 55.30% | 11.45% | 8.65% | NA |
| Temperate Japonica | 767 | 96.30% | 0.40% | 0.26% | 3.00% | NA |
| Tropical Japonica | 504 | 95.20% | 1.40% | 0.40% | 2.98% | NA |
| Japonica Intermediate | 241 | 90.50% | 4.60% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 36.50% | 25.00% | 5.21% | 33.33% | NA |
| Intermediate | 90 | 62.20% | 20.00% | 4.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406740172 | A -> DEL | N | N | silent_mutation | Average:10.393; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg0406740172 | A -> G | LOC_Os04g12220.1 | downstream_gene_variant ; 3389.0bp to feature; MODIFIER | silent_mutation | Average:10.393; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg0406740172 | A -> G | LOC_Os04g12200-LOC_Os04g12220 | intergenic_region ; MODIFIER | silent_mutation | Average:10.393; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406740172 | 9.36E-08 | 3.97E-08 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406740172 | 1.20E-08 | 4.07E-09 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406740172 | 7.72E-09 | 2.02E-08 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406740172 | 1.10E-08 | 2.42E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406740172 | 3.19E-06 | 4.02E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406740172 | 2.83E-06 | 8.30E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |