\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406740172:

Variant ID: vg0406740172 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6740172
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGACATTGTTAAATTTAATTTTATTAAAGTCTCCATGATTAGTTACGCTCTTTAGAATTTTATTGGAATTTTCAGAGCTTAATTGCTAATTTTAATAAT[A/G]
CAAACATCATTTAATAATTATTTAATTGGAAAAAGAAAGAAAATACTTCCTTTTAGGTTTGCTTAGAAATAAACACATTCAATACTATAATTGTAAATGC

Reverse complement sequence

GCATTTACAATTATAGTATTGAATGTGTTTATTTCTAAGCAAACCTAAAAGGAAGTATTTTCTTTCTTTTTCCAATTAAATAATTATTAAATGATGTTTG[T/C]
ATTATTAAAATTAGCAATTAAGCTCTGAAAATTCCAATAAAATTCTAAAGAGCGTAACTAATCATGGAGACTTTAATAAAATTAAATTTAACAATGTCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 38.00% 6.69% 5.71% NA
All Indica  2759 27.10% 56.00% 10.47% 6.42% NA
All Japonica  1512 95.00% 1.40% 0.40% 3.17% NA
Aus  269 25.70% 69.50% 4.46% 0.37% NA
Indica I  595 51.90% 37.50% 6.72% 3.87% NA
Indica II  465 27.30% 52.90% 11.40% 8.39% NA
Indica III  913 13.10% 70.10% 11.61% 5.15% NA
Indica Intermediate  786 24.60% 55.30% 11.45% 8.65% NA
Temperate Japonica  767 96.30% 0.40% 0.26% 3.00% NA
Tropical Japonica  504 95.20% 1.40% 0.40% 2.98% NA
Japonica Intermediate  241 90.50% 4.60% 0.83% 4.15% NA
VI/Aromatic  96 36.50% 25.00% 5.21% 33.33% NA
Intermediate  90 62.20% 20.00% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406740172 A -> DEL N N silent_mutation Average:10.393; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg0406740172 A -> G LOC_Os04g12220.1 downstream_gene_variant ; 3389.0bp to feature; MODIFIER silent_mutation Average:10.393; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg0406740172 A -> G LOC_Os04g12200-LOC_Os04g12220 intergenic_region ; MODIFIER silent_mutation Average:10.393; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406740172 9.36E-08 3.97E-08 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406740172 1.20E-08 4.07E-09 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406740172 7.72E-09 2.02E-08 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406740172 1.10E-08 2.42E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406740172 3.19E-06 4.02E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406740172 2.83E-06 8.30E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251