\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405387818:

Variant ID: vg0405387818 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5387818
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AACCAACCACGTGTGTTAAAGTCCTAAACTTTACACAGATGCTAATCATTTATATTTAATTATCATAACTTTATGAATCTCATAATGTGCTAGTCAAATC[C/T]
TTCGGCGGTGCCCATAGTAATCATGGTTACTTCGTCAGTTTTAAGATATGCTAATCATTTTTTTATGTGCATATAGGGACAAAGTGTAAGTGTCTGCCAT

Reverse complement sequence

ATGGCAGACACTTACACTTTGTCCCTATATGCACATAAAAAAATGATTAGCATATCTTAAAACTGACGAAGTAACCATGATTACTATGGGCACCGCCGAA[G/A]
GATTTGACTAGCACATTATGAGATTCATAAAGTTATGATAATTAAATATAAATGATTAGCATCTGTGTAAAGTTTAGGACTTTAACACACGTGGTTGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 8.10% 4.38% 5.69% NA
All Indica  2759 87.70% 0.50% 2.07% 9.68% NA
All Japonica  1512 66.30% 23.90% 9.72% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.00% 1.01% 0.00% NA
Indica II  465 93.10% 2.20% 1.72% 3.01% NA
Indica III  913 77.30% 0.00% 1.42% 21.25% NA
Indica Intermediate  786 88.20% 0.50% 3.82% 7.51% NA
Temperate Japonica  767 46.30% 41.70% 11.86% 0.13% NA
Tropical Japonica  504 93.70% 2.40% 3.97% 0.00% NA
Japonica Intermediate  241 73.00% 12.00% 14.94% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 7.80% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405387818 C -> DEL N N silent_mutation Average:45.607; most accessible tissue: Callus, score: 69.566 N N N N
vg0405387818 C -> T LOC_Os04g10010.1 upstream_gene_variant ; 603.0bp to feature; MODIFIER silent_mutation Average:45.607; most accessible tissue: Callus, score: 69.566 N N N N
vg0405387818 C -> T LOC_Os04g10020.1 downstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:45.607; most accessible tissue: Callus, score: 69.566 N N N N
vg0405387818 C -> T LOC_Os04g10010-LOC_Os04g10020 intergenic_region ; MODIFIER silent_mutation Average:45.607; most accessible tissue: Callus, score: 69.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405387818 NA 1.26E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405387818 NA 3.28E-11 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 3.43E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 3.65E-06 1.25E-15 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 7.31E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 3.15E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 3.19E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 2.52E-06 2.35E-14 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 9.44E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 3.35E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 4.70E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 1.59E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 7.28E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 1.07E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 1.63E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 4.10E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 2.21E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 4.92E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 2.95E-15 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 8.72E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 3.66E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 6.47E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405387818 NA 1.39E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251