Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403586262:

Variant ID: vg0403586262 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3586262
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATTTTGACATATGTGGTAATCCTTCAAGGTTGAAGTGTGCGAGGTGAACAACTGAATATAGCTCAAGGTTTATCCGTTCATCCGGGTTTAAGTATTAC[A/G]
CTTCACATAACTACTTTTATTTACGGCTAATTATTTTTTTCTGTGACATATAGCGCTTTCAATCATAGGGGTAGCAAGACACCAATGGTGACCTTGTCAA

Reverse complement sequence

TTGACAAGGTCACCATTGGTGTCTTGCTACCCCTATGATTGAAAGCGCTATATGTCACAGAAAAAAATAATTAGCCGTAAATAAAAGTAGTTATGTGAAG[T/C]
GTAATACTTAAACCCGGATGAACGGATAAACCTTGAGCTATATTCAGTTGTTCACCTCGCACACTTCAACCTTGAAGGATTACCACATATGTCAAAATGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	12.50%	0.68%	2.86%	NA
All Indica	2759	89.90%	5.40%	0.22%	4.49%	NA
All Japonica	1512	69.50%	28.60%	1.72%	0.20%	NA
Aus	269	94.80%	3.00%	0.00%	2.23%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	87.50%	8.20%	0.22%	4.09%	NA
Indica III	913	86.70%	4.70%	0.11%	8.43%	NA
Indica Intermediate	786	88.00%	7.90%	0.51%	3.56%	NA
Temperate Japonica	767	56.20%	42.90%	0.91%	0.00%	NA
Tropical Japonica	504	91.30%	7.30%	0.79%	0.60%	NA
Japonica Intermediate	241	66.40%	27.40%	6.22%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403586262	A -> DEL	N	N	silent_mutation	Average:32.106; most accessible tissue: Callus, score: 76.818	N	N	N	N
vg0403586262	A -> G	LOC_Os04g06790.1	upstream_gene_variant ; 4707.0bp to feature; MODIFIER	silent_mutation	Average:32.106; most accessible tissue: Callus, score: 76.818	N	N	N	N
vg0403586262	A -> G	LOC_Os04g06800.1	upstream_gene_variant ; 3056.0bp to feature; MODIFIER	silent_mutation	Average:32.106; most accessible tissue: Callus, score: 76.818	N	N	N	N
vg0403586262	A -> G	LOC_Os04g06790.2	upstream_gene_variant ; 4628.0bp to feature; MODIFIER	silent_mutation	Average:32.106; most accessible tissue: Callus, score: 76.818	N	N	N	N
vg0403586262	A -> G	LOC_Os04g06790.3	upstream_gene_variant ; 4628.0bp to feature; MODIFIER	silent_mutation	Average:32.106; most accessible tissue: Callus, score: 76.818	N	N	N	N
vg0403586262	A -> G	LOC_Os04g06800-LOC_Os04g06820	intergenic_region ; MODIFIER	silent_mutation	Average:32.106; most accessible tissue: Callus, score: 76.818	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403586262	NA	1.22E-11	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403586262	NA	7.03E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262	NA	1.69E-07	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262	NA	4.65E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262	NA	2.40E-08	mr1733_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262	NA	5.39E-10	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251