RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0402051720:

Variant ID: vg0402051720 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 2051720
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAACAAATAGACATTTTATGAAATGTCTATATGCCTTGCGGTATTTTCGTAGAGATATTTCCTTATGCATGCCTATAAGAAAGTAGATGCACTTTCTAC[A/G]
GGCACTAAATTGTGTGGCACTTTTTATGAAAATGTTGTATGAATTTCATCAAAGCTGATTTCATATGTCCTTTTTTCTACAAATTAATGAATCTTTTTTC

Reverse complement sequence

GAAAAAAGATTCATTAATTTGTAGAAAAAAGGACATATGAAATCAGCTTTGATGAAATTCATACAACATTTTCATAAAAAGTGCCACACAATTTAGTGCC[T/C]
GTAGAAAGTGCATCTACTTTCTTATAGGCATGCATAAGGAAATATCTCTACGAAAATACCGCAAGGCATATAGACATTTCATAAAATGTCTATTTGTTTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.50%	0.04%	0.00%	NA
All Indica	2759	96.90%	3.10%	0.04%	0.00%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	13.40%	86.20%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	93.80%	6.10%	0.11%	0.00%	NA
Indica Intermediate	786	96.40%	3.60%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0402051720	A -> G	LOC_Os04g04360.1	upstream_gene_variant ; 2915.0bp to feature; MODIFIER	silent_mutation	Average:29.224; most accessible tissue: Callus, score: 71.522	N	N	N	N
vg0402051720	A -> G	LOC_Os04g04340-LOC_Os04g04360	intergenic_region ; MODIFIER	silent_mutation	Average:29.224; most accessible tissue: Callus, score: 71.522	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0402051720	NA	1.74E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	7.44E-14	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	4.90E-50	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	1.68E-53	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	9.28E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	7.36E-06	NA	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	2.09E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	8.03E-51	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	NA	2.94E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0402051720	5.23E-06	4.95E-44	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0402051720:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact