Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400681180:

Variant ID: vg0400681180 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 681180
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, T: 0.01, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAATTCTCAAATTAATACACTTTACTTCTTTTCCAACCACTGTTGAGTAACCACGTCTTTCGACGTATGCGGTTGTCGTTTCGACAATACTATTATA[A/C,T]
ACTAAAAGTTCAGTACATTTCCTAAAAAACACTCGTACACCATCACATGATACCTTCTAAAATCAGAGAAATCCTCGAAATTCTAAAAAAAAAATCTGAC

Reverse complement sequence

GTCAGATTTTTTTTTTAGAATTTCGAGGATTTCTCTGATTTTAGAAGGTATCATGTGATGGTGTACGAGTGTTTTTTAGGAAATGTACTGAACTTTTAGT[T/G,A]
TATAATAGTATTGTCGAAACGACAACCGCATACGTCGAAAGACGTGGTTACTCAACAGTGGTTGGAAAAGAAGTAAAGTGTATTAATTTGAGAATTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	18.50%	0.28%	2.01%	T: 12.17%
All Indica	2759	75.60%	1.00%	0.33%	2.61%	T: 20.48%
All Japonica	1512	46.10%	52.20%	0.07%	1.46%	T: 0.20%
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	91.80%	1.00%	0.00%	0.00%	T: 7.23%
Indica II	465	63.40%	2.60%	1.08%	8.60%	T: 24.30%
Indica III	913	68.90%	0.20%	0.00%	1.64%	T: 29.24%
Indica Intermediate	786	78.20%	1.00%	0.51%	2.16%	T: 18.07%
Temperate Japonica	767	13.60%	86.30%	0.13%	0.00%	NA
Tropical Japonica	504	86.30%	9.10%	0.00%	4.37%	T: 0.20%
Japonica Intermediate	241	65.60%	33.60%	0.00%	0.00%	T: 0.83%
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	18.90%	3.33%	1.11%	T: 7.78%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400681180	A -> C	LOC_Os04g02110.1	3_prime_UTR_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> C	LOC_Os04g02110.3	3_prime_UTR_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> C	LOC_Os04g02090.1	upstream_gene_variant ; 4516.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> C	LOC_Os04g02100.1	downstream_gene_variant ; 192.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> C	LOC_Os04g02110.2	downstream_gene_variant ; 2525.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> DEL	N	N	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> T	LOC_Os04g02110.1	3_prime_UTR_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> T	LOC_Os04g02110.3	3_prime_UTR_variant ; 3111.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> T	LOC_Os04g02090.1	upstream_gene_variant ; 4516.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> T	LOC_Os04g02100.1	downstream_gene_variant ; 192.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg0400681180	A -> T	LOC_Os04g02110.2	downstream_gene_variant ; 2525.0bp to feature; MODIFIER	silent_mutation	Average:78.314; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N