Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400681165:

Variant ID: vg0400681165 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 681165
Reference Allele: G	Alternative Allele: A,GACAACAGGA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGGGATCCCAAGTAAAAAATTCTCAAATTAATACACTTTACTTCTTTTCCAACCACTGTTGAGTAACCACGTCTTTCGACGTATGCGGTTGTCGTTTC[G/A,GACAACAGGA]
ACAATACTATTATAAACTAAAAGTTCAGTACATTTCCTAAAAAACACTCGTACACCATCACATGATACCTTCTAAAATCAGAGAAATCCTCGAAATTCTA

Reverse complement sequence

TAGAATTTCGAGGATTTCTCTGATTTTAGAAGGTATCATGTGATGGTGTACGAGTGTTTTTTAGGAAATGTACTGAACTTTTAGTTTATAATAGTATTGT[C/T,TCCTGTTGTC]
GAAACGACAACCGCATACGTCGAAAGACGTGGTTACTCAACAGTGGTTGGAAAAGAAGTAAAGTGTATTAATTTGAGAATTTTTTACTTGGGATCCCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.90%	0.40%	0.59%	1.04%	NA
All Indica	2759	97.10%	0.80%	0.36%	1.74%	NA
All Japonica	1512	98.80%	0.00%	1.12%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	92.70%	0.00%	0.43%	6.88%	NA
Indica III	913	96.90%	2.20%	0.77%	0.11%	NA
Indica Intermediate	786	97.80%	0.10%	0.13%	1.91%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	0.00%	3.37%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400681165	G -> DEL	N	N	silent_mutation	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> GACAACAGGA	LOC_Os04g02110.1	3_prime_UTR_variant ; 3125.0bp to feature; MODIFIER	N	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> GACAACAGGA	LOC_Os04g02110.3	3_prime_UTR_variant ; 3125.0bp to feature; MODIFIER	N	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> GACAACAGGA	LOC_Os04g02090.1	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	N	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> GACAACAGGA	LOC_Os04g02100.1	downstream_gene_variant ; 178.0bp to feature; MODIFIER	N	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> GACAACAGGA	LOC_Os04g02110.2	downstream_gene_variant ; 2539.0bp to feature; MODIFIER	N	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> A	LOC_Os04g02110.1	3_prime_UTR_variant ; 3126.0bp to feature; MODIFIER	silent_mutation	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> A	LOC_Os04g02110.3	3_prime_UTR_variant ; 3126.0bp to feature; MODIFIER	silent_mutation	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> A	LOC_Os04g02090.1	upstream_gene_variant ; 4501.0bp to feature; MODIFIER	silent_mutation	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> A	LOC_Os04g02100.1	downstream_gene_variant ; 177.0bp to feature; MODIFIER	silent_mutation	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N
vg0400681165	G -> A	LOC_Os04g02110.2	downstream_gene_variant ; 2540.0bp to feature; MODIFIER	silent_mutation	Average:75.167; most accessible tissue: Minghui63 flag leaf, score: 86.0	N	N	N	N