Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400215019:

Variant ID: vg0400215019 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 215019
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAAAATCGTTTTTTGACGGTTATTTTTTAAAATTTTGTGTTAGAGTATATAAATATAGGAGAAAAACCTTGACATTTCATATTATATATAAAATGAT[G/A]
TTGTTTTGGATGAAGAGTTTATGAGGGATGAATGAGATAACAGGGGAGTATGTTAGAAGCATTGATTCAGGAGGAAATTAGGGCCCCTTTAAATCACGGG

Reverse complement sequence

CCCGTGATTTAAAGGGGCCCTAATTTCCTCCTGAATCAATGCTTCTAACATACTCCCCTGTTATCTCATTCATCCCTCATAAACTCTTCATCCAAAACAA[C/T]
ATCATTTTATATATAATATGAAATGTCAAGGTTTTTCTCCTATATTTATATACTCTAACACAAAATTTTAAAAAATAACCGTCAAAAAACGATTTTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 48.60% 0.28% 0.00% NA
All Indica  2759 83.40% 16.30% 0.22% 0.00% NA
All Japonica  1512 0.80% 98.90% 0.26% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 84.20% 15.60% 0.17% 0.00% NA
Indica II  465 91.60% 8.40% 0.00% 0.00% NA
Indica III  913 84.10% 15.80% 0.11% 0.00% NA
Indica Intermediate  786 77.20% 22.30% 0.51% 0.00% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 0.00% 99.60% 0.40% 0.00% NA
Japonica Intermediate  241 3.70% 95.90% 0.41% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 41.10% 55.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0400215019 G -> A LOC_Os04g01280.1 upstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:48.79; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N
vg0400215019 G -> A LOC_Os04g01290.1 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:48.79; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N
vg0400215019 G -> A LOC_Os04g01290.2 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:48.79; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N
vg0400215019 G -> A LOC_Os04g01290.3 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:48.79; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N
vg0400215019 G -> A LOC_Os04g01270-LOC_Os04g01280 intergenic_region ; MODIFIER silent_mutation Average:48.79; most accessible tissue: Zhenshan97 flower, score: 68.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0400215019 NA 1.98E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 3.18E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.71E-29 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.65E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 4.45E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 3.35E-28 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 8.73E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 3.89E-32 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 7.73E-17 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.27E-13 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 2.85E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 3.53E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 6.45E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.03E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.36E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.86E-32 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.09E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 2.18E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 7.81E-47 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 6.38E-12 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.89E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 6.37E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 4.09E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 3.07E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 5.53E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.32E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 4.95E-11 mr1666 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 8.04E-21 mr1700 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.00E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 5.38E-08 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 7.25E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 8.37E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 2.29E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 4.38E-07 5.97E-12 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 4.33E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 6.95E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.40E-55 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 7.46E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 7.88E-13 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 2.23E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.13E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 1.99E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 6.65E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 4.48E-49 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 4.83E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400215019 NA 2.91E-69 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251