Search for Variation information by Variation ID:
Detailed information for vg0335314343:
| Variant ID: vg0335314343 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35314343 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.01, others allele: 0.00, population size: 313. )
Flanking Sequence (100 bp) in Reference Genome:
CTGTGCCTGAAAATCCTCTGAGAGGAGGATATTCGAAGACTTAACATCTCCATGAATCACAGATTGGGTGACACTTCCATGATGTAGATATTCAAGTGCC[T/A]
TTGCTATGCCAATTGCTATTTTGTTTCTCTTCTCCCAGCTAAGGCTATCCTTGCTGTCATGCTTGCCTGAAGAGCAGTTACAACCAGTCAATCACAAAGT
Reverse complement sequence
ACTTTGTGATTGACTGGTTGTAACTGCTCTTCAGGCAAGCATGACAGCAAGGATAGCCTTAGCTGGGAGAAGAGAAACAAAATAGCAATTGGCATAGCAA[A/T]
GGCACTTGAATATCTACATCATGGAAGTGTCACCCAATCTGTGATTCATGGAGATGTTAAGTCTTCGAATATCCTCCTCTCAGAGGATTTTCAGGCACAG
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.90% | 42.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 63.00% | 37.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.40% | 68.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.60% | 30.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 69.10% | 30.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.90% | 89.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335314343 | T -> A | LOC_Os03g62340.1 | missense_variant ; p.Lys701Met; MODERATE | nonsynonymous_codon ; K701M | Average:63.393; most accessible tissue: Minghui63 young leaf, score: 78.443 | benign  |
0.773 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335314343 | NA | 5.26E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 4.65E-09 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 1.55E-06 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 1.20E-06 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 2.54E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 6.46E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 3.14E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 1.23E-07 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 1.53E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335314343 | NA | 2.58E-11 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |