Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335310303:

Variant ID: vg0335310303 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35310303
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGAATTAATTATTATTTAAATTTTTTTAAATAAGACGAACAGTCAAATATTTTTAAAAAAGTCAACGGCGTCAAACATTTTGGGATAAAGGGAGTAT[G/A]
AATATTTACACAATCTTGTCGCCATAGAGCACCGTGAAGGCTATGTCGTCCTCGTCCTTTGAATTGGCTGACCGTCCCCGCCGCGGCCGCGTGAACGGCA

Reverse complement sequence

TGCCGTTCACGCGGCCGCGGCGGGGACGGTCAGCCAATTCAAAGGACGAGGACGACATAGCCTTCACGGTGCTCTATGGCGACAAGATTGTGTAAATATT[C/T]
ATACTCCCTTTATCCCAAAATGTTTGACGCCGTTGACTTTTTTAAAAATATTTGACTGTTCGTCTTATTTAAAAAAATTTAAATAATAATTAATTCTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.50% 0.13% 0.00% NA
All Indica  2759 61.90% 37.90% 0.14% 0.00% NA
All Japonica  1512 54.60% 45.30% 0.07% 0.00% NA
Aus  269 80.70% 19.30% 0.00% 0.00% NA
Indica I  595 32.10% 67.60% 0.34% 0.00% NA
Indica II  465 79.80% 20.20% 0.00% 0.00% NA
Indica III  913 66.00% 33.80% 0.11% 0.00% NA
Indica Intermediate  786 69.10% 30.80% 0.13% 0.00% NA
Temperate Japonica  767 89.80% 10.00% 0.13% 0.00% NA
Tropical Japonica  504 11.10% 88.90% 0.00% 0.00% NA
Japonica Intermediate  241 33.60% 66.40% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335310303 G -> A LOC_Os03g62330.1 3_prime_UTR_variant ; 6.0bp to feature; MODIFIER silent_mutation Average:76.362; most accessible tissue: Minghui63 root, score: 91.589 N N N N
vg0335310303 G -> A LOC_Os03g62314.1 upstream_gene_variant ; 917.0bp to feature; MODIFIER silent_mutation Average:76.362; most accessible tissue: Minghui63 root, score: 91.589 N N N N
vg0335310303 G -> A LOC_Os03g62340.1 downstream_gene_variant ; 2148.0bp to feature; MODIFIER silent_mutation Average:76.362; most accessible tissue: Minghui63 root, score: 91.589 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335310303 G A 0.12 0.06 0.03 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335310303 NA 5.26E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310303 NA 1.20E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310303 NA 2.54E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310303 NA 6.46E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310303 NA 1.23E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310303 NA 1.62E-08 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251