Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335310293:

Variant ID: vg0335310293 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35310293
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGATAGGAAAAGAATTAATTATTATTTAAATTTTTTTAAATAAGACGAACAGTCAAATATTTTTAAAAAAGTCAACGGCGTCAAACATTTTGGGATA[A/G]
AGGGAGTATGAATATTTACACAATCTTGTCGCCATAGAGCACCGTGAAGGCTATGTCGTCCTCGTCCTTTGAATTGGCTGACCGTCCCCGCCGCGGCCGC

Reverse complement sequence

GCGGCCGCGGCGGGGACGGTCAGCCAATTCAAAGGACGAGGACGACATAGCCTTCACGGTGCTCTATGGCGACAAGATTGTGTAAATATTCATACTCCCT[T/C]
TATCCCAAAATGTTTGACGCCGTTGACTTTTTTAAAAATATTTGACTGTTCGTCTTATTTAAAAAAATTTAAATAATAATTAATTCTTTTCCTATCATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.50% 0.04% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 48.00% 51.90% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 12.10% 87.60% 0.26% 0.00% NA
Tropical Japonica  504 93.70% 6.30% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 33.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335310293 A -> G LOC_Os03g62330.1 3_prime_UTR_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:76.111; most accessible tissue: Minghui63 root, score: 91.481 N N N N
vg0335310293 A -> G LOC_Os03g62314.1 upstream_gene_variant ; 907.0bp to feature; MODIFIER silent_mutation Average:76.111; most accessible tissue: Minghui63 root, score: 91.481 N N N N
vg0335310293 A -> G LOC_Os03g62340.1 downstream_gene_variant ; 2158.0bp to feature; MODIFIER silent_mutation Average:76.111; most accessible tissue: Minghui63 root, score: 91.481 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335310293 A G 0.03 0.01 -0.02 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335310293 NA 4.79E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 1.29E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 3.23E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 2.70E-22 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 1.01E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 1.22E-21 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 7.09E-27 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 1.65E-37 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 5.38E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 7.66E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 9.52E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 1.82E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 8.16E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 1.51E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 2.77E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310293 NA 2.69E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251