Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335310245:

Variant ID: vg0335310245 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35310245
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AATATGTAAAACTATATGTATATATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAATTATTATTTAAATTTTTTTAAATAAGACGAA[C/T]
AGTCAAATATTTTTAAAAAAGTCAACGGCGTCAAACATTTTGGGATAAAGGGAGTATGAATATTTACACAATCTTGTCGCCATAGAGCACCGTGAAGGCT

Reverse complement sequence

AGCCTTCACGGTGCTCTATGGCGACAAGATTGTGTAAATATTCATACTCCCTTTATCCCAAAATGTTTGACGCCGTTGACTTTTTTAAAAATATTTGACT[G/A]
TTCGTCTTATTTAAAAAAATTTAAATAATAATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATATATACATATAGTTTTACATATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 18.40% 0.13% 0.00% NA
All Indica  2759 69.30% 30.60% 0.11% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 77.50% 22.50% 0.00% 0.00% NA
Indica II  465 44.10% 55.50% 0.43% 0.00% NA
Indica III  913 83.80% 16.10% 0.11% 0.00% NA
Indica Intermediate  786 61.10% 38.90% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335310245 C -> T LOC_Os03g62330.1 3_prime_UTR_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:75.649; most accessible tissue: Minghui63 root, score: 91.22 N N N N
vg0335310245 C -> T LOC_Os03g62314.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:75.649; most accessible tissue: Minghui63 root, score: 91.22 N N N N
vg0335310245 C -> T LOC_Os03g62340.1 downstream_gene_variant ; 2206.0bp to feature; MODIFIER silent_mutation Average:75.649; most accessible tissue: Minghui63 root, score: 91.22 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335310245 C T 0.03 0.0 -0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335310245 NA 8.12E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 2.99E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 3.11E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 3.92E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 2.91E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 2.72E-08 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 2.27E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 1.52E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 2.95E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310245 NA 5.04E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251