Variant ID: vg0335310114 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 35310114 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGACAAATCGACCTTTAATAAAATTTATTTTGAAAATAGACCCAAAATATTCCTTACTTCCCTAAATGTTTGACGCTGTTGACTTTTTAAAGTATGTTT[A/G]
ACCATTTGTCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATATATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAGAATTAAT
ATTAATTCTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATATATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGACAAATGGT[T/C]
AAACATACTTTAAAAAGTCAACAGCGTCAAACATTTAGGGAAGTAAGGAATATTTTGGGTCTATTTTCAAAATAAATTTTATTAAAGGTCGATTTGTCAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 82.50% | 17.50% | 0.04% | 0.00% | NA |
All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 48.00% | 51.90% | 0.13% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 12.10% | 87.60% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0335310114 | A -> G | LOC_Os03g62330.1 | 3_prime_UTR_variant ; 195.0bp to feature; MODIFIER | silent_mutation | Average:59.353; most accessible tissue: Minghui63 root, score: 79.74 | N | N | N | N |
vg0335310114 | A -> G | LOC_Os03g62314.1 | upstream_gene_variant ; 728.0bp to feature; MODIFIER | silent_mutation | Average:59.353; most accessible tissue: Minghui63 root, score: 79.74 | N | N | N | N |
vg0335310114 | A -> G | LOC_Os03g62340.1 | downstream_gene_variant ; 2337.0bp to feature; MODIFIER | silent_mutation | Average:59.353; most accessible tissue: Minghui63 root, score: 79.74 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0335310114 | NA | 7.70E-30 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 2.16E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 3.42E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 8.02E-25 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 6.30E-36 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 5.38E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 7.66E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 9.52E-07 | mr1554_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 2.77E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 2.69E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0335310114 | NA | 3.68E-12 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |