Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335310101:

Variant ID: vg0335310101 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35310101
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

AACAGCCGAAATTCTGACAAATCGACCTTTAATAAAATTTATTTTGAAAATAGACCCAAAATATTCCTTACTTCCCTAAATGTTTGACGCTGTTGACTTT[T/C]
TAAAGTATGTTTAACCATTTGTCTTATTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATATATAAAAGTATATTTAACAATAAATCAAATGATAG

Reverse complement sequence

CTATCATTTGATTTATTGTTAAATATACTTTTATATATACATATAGTTTTACATATTTCACAAAAGTTTTTGAATAAGACAAATGGTTAAACATACTTTA[A/G]
AAAGTCAACAGCGTCAAACATTTAGGGAAGTAAGGAATATTTTGGGTCTATTTTCAAAATAAATTTTATTAAAGGTCGATTTGTCAGAATTTCGGCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.30%	40.60%	0.08%	0.00%	NA
All Indica	2759	61.80%	38.10%	0.04%	0.00%	NA
All Japonica	1512	54.50%	45.40%	0.13%	0.00%	NA
Aus	269	80.70%	19.30%	0.00%	0.00%	NA
Indica I	595	32.10%	67.70%	0.17%	0.00%	NA
Indica II	465	80.00%	20.00%	0.00%	0.00%	NA
Indica III	913	65.90%	34.10%	0.00%	0.00%	NA
Indica Intermediate	786	68.80%	31.20%	0.00%	0.00%	NA
Temperate Japonica	767	89.70%	10.00%	0.26%	0.00%	NA
Tropical Japonica	504	10.90%	89.10%	0.00%	0.00%	NA
Japonica Intermediate	241	33.60%	66.40%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335310101	T -> C	LOC_Os03g62330.1	3_prime_UTR_variant ; 208.0bp to feature; MODIFIER	silent_mutation	Average:58.333; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N
vg0335310101	T -> C	LOC_Os03g62314.1	upstream_gene_variant ; 715.0bp to feature; MODIFIER	silent_mutation	Average:58.333; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N
vg0335310101	T -> C	LOC_Os03g62340.1	downstream_gene_variant ; 2350.0bp to feature; MODIFIER	silent_mutation	Average:58.333; most accessible tissue: Minghui63 root, score: 78.833	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335310101	NA	5.26E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310101	NA	1.20E-06	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310101	NA	2.54E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310101	NA	6.46E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310101	NA	1.23E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335310101	NA	1.31E-08	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251