Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335146264:

Variant ID: vg0335146264 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35146264
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GATACGAGCAGGCGGCGAGGAAGACGGAGGTGTTCCGCCTCTCGTCCGGCTCCGACGCGGCGCCGGCCGCGCTGGGGAGCGGCGGCGAGAGGGAGTACCG[G/A]
AAGGAGAGCGACAATGGCGGGGTGTTCGACGTCGAGGTGGACCTGTCCGGCGAGGTGAAGTACGCGCTGCACAGCGCGTGGTGCAGGGTGGAGGCCAGGT

Reverse complement sequence

ACCTGGCCTCCACCCTGCACCACGCGCTGTGCAGCGCGTACTTCACCTCGCCGGACAGGTCCACCTCGACGTCGAACACCCCGCCATTGTCGCTCTCCTT[C/T]
CGGTACTCCCTCTCGCCGCCGCTCCCCAGCGCGGCCGGCGCCGCGTCGGAGCCGGACGAGAGGCGGAACACCTCCGTCTTCCTCGCCGCCTGCTCGTATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	32.10%	0.34%	0.17%	NA
All Indica	2759	53.20%	46.00%	0.51%	0.25%	NA
All Japonica	1512	98.10%	1.70%	0.07%	0.07%	NA
Aus	269	30.90%	69.10%	0.00%	0.00%	NA
Indica I	595	72.90%	26.60%	0.34%	0.17%	NA
Indica II	465	35.70%	61.90%	1.29%	1.08%	NA
Indica III	913	59.40%	40.50%	0.00%	0.11%	NA
Indica Intermediate	786	41.50%	57.80%	0.76%	0.00%	NA
Temperate Japonica	767	99.30%	0.50%	0.00%	0.13%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335146264	G -> A	LOC_Os03g62020.1	synonymous_variant ; p.Arg146Arg; LOW	synonymous_codon	Average:87.007; most accessible tissue: Minghui63 flower, score: 89.852	N	N	N	N
vg0335146264	G -> DEL	LOC_Os03g62020.1	N	frameshift_variant	Average:87.007; most accessible tissue: Minghui63 flower, score: 89.852	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0335146264	G	A	-0.01	-0.02	-0.02	-0.01	-0.01	-0.01