Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335146049:

Variant ID: vg0335146049 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 35146049
Reference Allele: GAlternative Allele: T,GCTGA
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, T: 0.13, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCTACGGCCGCGTCTCCAGCCTCAGGGTCGCCGTCGACGACGCCTCCCTGACGCGCTTCGCGGTGACCGCCACCTCCGTCGCCTACAACCTCACCGTC[G/T,GCTGA]
CGCTCGTCGTCCGCAACCCCAACTGGGCCATGGGCGTCACCTACCGCTCCCTCGAGGCGTCCTACCTCTTCCACGGCAAGCGCTTCGACGGCGCCGCCGC

Reverse complement sequence

GCGGCGGCGCCGTCGAAGCGCTTGCCGTGGAAGAGGTAGGACGCCTCGAGGGAGCGGTAGGTGACGCCCATGGCCCAGTTGGGGTTGCGGACGACGAGCG[C/A,TCAGC]
GACGGTGAGGTTGTAGGCGACGGAGGTGGCGGTCACCGCGAAGCGCGTCAGGGAGGCGTCGTCGACGGCGACCCTGAGGCTGGAGACGCGGCCGTAGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 32.10% 0.19% 0.40% NA
All Indica  2759 53.00% 46.10% 0.29% 0.62% NA
All Japonica  1512 98.10% 1.70% 0.07% 0.13% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 72.80% 26.70% 0.17% 0.34% NA
Indica II  465 35.50% 61.70% 0.43% 2.37% NA
Indica III  913 59.30% 40.50% 0.11% 0.11% NA
Indica Intermediate  786 41.20% 57.90% 0.51% 0.38% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 95.80% 4.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335146049 G -> T LOC_Os03g62020.1 missense_variant ; p.Ala75Ser; MODERATE nonsynonymous_codon ; A75S Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 unknown unknown TOLERATED 0.18
vg0335146049 G -> GCTGA LOC_Os03g62020.1 frameshift_variant ; p.Leu76fs; HIGH N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62040.1 upstream_gene_variant ; 4288.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62010.1 downstream_gene_variant ; 4834.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62030.1 downstream_gene_variant ; 1191.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62030.3 downstream_gene_variant ; 1191.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62030.4 downstream_gene_variant ; 1191.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62030.2 downstream_gene_variant ; 1191.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> GCTGA LOC_Os03g62030.5 downstream_gene_variant ; 1191.0bp to feature; MODIFIER N Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N
vg0335146049 G -> DEL LOC_Os03g62020.1 N frameshift_variant Average:85.393; most accessible tissue: Minghui63 young leaf, score: 87.677 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335146049 G GCTGA -0.19 0.02 0.07 -0.06 -0.12 -0.16
vg0335146049 G T 0.0 -0.01 -0.01 0.0 0.0 0.0