| Variant ID: vg0333189331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 33189331 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 309. )
CGGATGAAAGTGGAAATCCAACTGAAAGGGCTAAGGTGAAAATAGGACACATGCATGCATGACGAGGTAGGTTAATTATGTACAGAATCTATATTACAAG[C/G]
AAGCAATGAATGATCACCTTCGTTGTAATCTTTGATCAGCAGGTCTTGCAGTTCCAGTGGTCTCAGCTTCTCCCTCCATGTCATCATCATCTGACTGCTC
GAGCAGTCAGATGATGATGACATGGAGGGAGAAGCTGAGACCACTGGAACTGCAAGACCTGCTGATCAAAGATTACAACGAAGGTGATCATTCATTGCTT[G/C]
CTTGTAATATAGATTCTGTACATAATTAACCTACCTCGTCATGCATGCATGTGTCCTATTTTCACCTTAGCCCTTTCAGTTGGATTTCCACTTTCATCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.50% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 91.20% | 8.60% | 0.18% | 0.04% | NA |
| All Japonica | 1512 | 0.80% | 99.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.10% | 16.40% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 0.70% | 99.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 60.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0333189331 | C -> DEL | N | N | silent_mutation | Average:66.95; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0333189331 | C -> G | LOC_Os03g58240.1 | downstream_gene_variant ; 2102.0bp to feature; MODIFIER | silent_mutation | Average:66.95; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0333189331 | C -> G | LOC_Os03g58260.2 | downstream_gene_variant ; 4404.0bp to feature; MODIFIER | silent_mutation | Average:66.95; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0333189331 | C -> G | LOC_Os03g58250.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.95; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0333189331 | NA | 4.36E-26 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 8.25E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 6.94E-26 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 1.11E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 3.83E-28 | mr1426 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 1.51E-08 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 2.17E-43 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 2.78E-11 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 1.38E-24 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0333189331 | NA | 3.84E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/