RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0333189200:

Variant ID: vg0333189200 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33189200
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTGCTACGTGTAATGGCCATACAAATTCCTCTCTTGCTCGAGACACTAAGCACTGAGTATGGCACACAGAGAACTAATATGGTAGGTAAAAGATCATA[T/A]
ATGCGATGCAATAGGAAACTGAAAGGCTACCGGATGAAAGTGGAAATCCAACTGAAAGGGCTAAGGTGAAAATAGGACACATGCATGCATGACGAGGTAG

Reverse complement sequence

CTACCTCGTCATGCATGCATGTGTCCTATTTTCACCTTAGCCCTTTCAGTTGGATTTCCACTTTCATCCGGTAGCCTTTCAGTTTCCTATTGCATCGCAT[A/T]
TATGATCTTTTACCTACCATATTAGTTCTCTGTGTGCCATACTCAGTGCTTAGTGTCTCGAGCAAGAGAGGAATTTGTATGGCCATTACACGTAGCACTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.30%	42.10%	0.28%	0.36%	NA
All Indica	2759	28.00%	71.10%	0.36%	0.54%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	13.40%	85.50%	0.67%	0.34%	NA
Indica II	465	56.30%	41.70%	1.08%	0.86%	NA
Indica III	913	17.00%	82.80%	0.00%	0.22%	NA
Indica Intermediate	786	35.00%	64.00%	0.13%	0.89%	NA
Temperate Japonica	767	99.60%	0.10%	0.13%	0.13%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	24.40%	1.11%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333189200	T -> A	LOC_Os03g58240.1	downstream_gene_variant ; 1971.0bp to feature; MODIFIER	silent_mutation	Average:62.205; most accessible tissue: Callus, score: 86.532	N	N	N	N
vg0333189200	T -> A	LOC_Os03g58260.2	downstream_gene_variant ; 4535.0bp to feature; MODIFIER	silent_mutation	Average:62.205; most accessible tissue: Callus, score: 86.532	N	N	N	N
vg0333189200	T -> A	LOC_Os03g58250.1	intron_variant ; MODIFIER	silent_mutation	Average:62.205; most accessible tissue: Callus, score: 86.532	N	N	N	N
vg0333189200	T -> DEL	N	N	silent_mutation	Average:62.205; most accessible tissue: Callus, score: 86.532	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333189200	NA	5.74E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	3.78E-08	NA	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	1.45E-07	1.37E-09	mr1723	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	NA	1.57E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	NA	2.54E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	5.12E-11	2.24E-36	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	1.01E-09	7.37E-13	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189200	NA	6.47E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0333189200:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact