RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0333189116:

Variant ID: vg0333189116 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33189116
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.13, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAACTTGTGACATAAGGAATATGATGTGAACTCAGATTTAATTCATCCCAAATTGCTTATGTCAATAAACAAGTAGAGAGCAAAGTGCTACGTGTAAT[G/A]
GCCATACAAATTCCTCTCTTGCTCGAGACACTAAGCACTGAGTATGGCACACAGAGAACTAATATGGTAGGTAAAAGATCATATATGCGATGCAATAGGA

Reverse complement sequence

TCCTATTGCATCGCATATATGATCTTTTACCTACCATATTAGTTCTCTGTGTGCCATACTCAGTGCTTAGTGTCTCGAGCAAGAGAGGAATTTGTATGGC[C/T]
ATTACACGTAGCACTTTGCTCTCTACTTGTTTATTGACATAAGCAATTTGGGATGAATTAAATCTGAGTTCACATCATATTCCTTATGTCACAAGTTTCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	38.50%	0.28%	0.00%	NA
All Indica	2759	93.50%	6.10%	0.36%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.07%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	92.40%	7.20%	0.34%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	97.50%	2.40%	0.11%	0.00%	NA
Indica Intermediate	786	88.30%	10.90%	0.76%	0.00%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.40%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	41.10%	56.70%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333189116	G -> A	LOC_Os03g58240.1	downstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:61.038; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0333189116	G -> A	LOC_Os03g58260.2	downstream_gene_variant ; 4619.0bp to feature; MODIFIER	silent_mutation	Average:61.038; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0333189116	G -> A	LOC_Os03g58250.1	intron_variant ; MODIFIER	silent_mutation	Average:61.038; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333189116	NA	1.08E-38	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189116	2.35E-16	3.54E-47	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189116	4.20E-14	4.08E-18	mr1723	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189116	4.50E-16	1.50E-52	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333189116	2.03E-14	2.58E-18	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0333189116:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact