RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0333188467:

Variant ID: vg0333188467 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 33188467
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, C: 0.08, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTAATTGCGATACCTGTAACAAGTAAATCCATAACTGAAGTCAGTAGCCAGTAATTTAGGATTTTATGTCTTATCGAAAATAACTATGTGAACTATCA[G/C]
ACCTGTGCCTCCAGCTCATTCAAGTGAGCTGCCTTTCTGCTTCTTGAGCGCCTGGCTGACTCCCGATTGGATTGCTTCCTGGAACAGGTCAACAAAACTA

Reverse complement sequence

TAGTTTTGTTGACCTGTTCCAGGAAGCAATCCAATCGGGAGTCAGCCAGGCGCTCAAGAAGCAGAAAGGCAGCTCACTTGAATGAGCTGGAGGCACAGGT[C/G]
TGATAGTTCACATAGTTATTTTCGATAAGACATAAAATCCTAAATTACTGGCTACTGACTTCAGTTATGGATTTACTTGTTACAGGTATCGCAATTAAGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	45.50%	0.13%	0.25%	NA
All Indica	2759	90.90%	8.60%	0.18%	0.29%	NA
All Japonica	1512	0.90%	99.00%	0.00%	0.13%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	92.80%	7.20%	0.00%	0.00%	NA
Indica II	465	92.90%	6.70%	0.22%	0.22%	NA
Indica III	913	96.20%	3.70%	0.00%	0.11%	NA
Indica Intermediate	786	82.30%	16.40%	0.51%	0.76%	NA
Temperate Japonica	767	0.80%	99.10%	0.00%	0.13%	NA
Tropical Japonica	504	1.20%	98.60%	0.00%	0.20%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	35.60%	61.10%	1.11%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0333188467	G -> C	LOC_Os03g58250.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:70.427; most accessible tissue: Callus, score: 92.095	N	N	N	N
vg0333188467	G -> C	LOC_Os03g58240.1	downstream_gene_variant ; 1238.0bp to feature; MODIFIER	silent_mutation	Average:70.427; most accessible tissue: Callus, score: 92.095	N	N	N	N
vg0333188467	G -> DEL	N	N	silent_mutation	Average:70.427; most accessible tissue: Callus, score: 92.095	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0333188467	NA	4.36E-26	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	8.25E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	6.94E-26	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	1.11E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	3.83E-28	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	1.51E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	2.17E-43	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	2.78E-11	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	1.38E-24	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333188467	NA	3.84E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 20 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0333188467:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact