RiceVarMap2

Detailed information for vg0332251368:

Variant ID: vg0332251368 (JBrowse)

Variation Type: SNP

Chromosome: chr03

Position: 32251368

Reference Allele: A

Alternative Allele: G

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.14, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTCAGGGCTTTCAGTCTAGCCAATCCAAGGTCAGTGACTCACATTCTGTATTGGGCAACATCCACCATTGCCAGATCACCATGCACTCAAACTCATTC[A/G]
AATAGCGCACTGTTTGTCTGTGGACTTTCCATTTTTCAGGGATCAAATTAGGTTGGCAATAACATTGGCCTTGTATGACAATTATCTGAAGCTCCCTTCC

Reverse complement sequence

GGAAGGGAGCTTCAGATAATTGTCATACAAGGCCAATGTTATTGCCAACCTAATTTGATCCCTGAAAAATGGAAAGTCCACAGACAAACAGTGCGCTATT[T/C]
GAATGAGTTTGAGTGCATGGTGATCTGGCAATGGTGGATGTTGCCCAATACAGAATGTGAGTCACTGACCTTGGATTGGCTAGACTGAAAGCCCTGAACC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	34.90%	0.04%	0.30%	NA
All Indica	2759	98.40%	1.20%	0.04%	0.43%	NA
All Japonica	1512	1.40%	98.50%	0.07%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.00%	0.50%	NA
Indica II	465	96.60%	2.60%	0.00%	0.86%	NA
Indica III	913	98.70%	1.10%	0.11%	0.11%	NA
Indica Intermediate	786	98.30%	1.10%	0.00%	0.51%	NA
Temperate Japonica	767	0.30%	99.50%	0.13%	0.13%	NA
Tropical Japonica	504	3.40%	96.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	0.00%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0332251368	A -> DEL	N	N	silent_mutation	Average:76.421; most accessible tissue: Callus, score: 80.691	N	N	N	N
vg0332251368	A -> G	LOC_Os03g56630.1	3_prime_UTR_variant ; 741.0bp to feature; MODIFIER	silent_mutation	Average:76.421; most accessible tissue: Callus, score: 80.691	N	N	N	N
vg0332251368	A -> G	LOC_Os03g56630.2	3_prime_UTR_variant ; 741.0bp to feature; MODIFIER	silent_mutation	Average:76.421; most accessible tissue: Callus, score: 80.691	N	N	N	N
vg0332251368	A -> G	LOC_Os03g56610.1	upstream_gene_variant ; 4548.0bp to feature; MODIFIER	silent_mutation	Average:76.421; most accessible tissue: Callus, score: 80.691	N	N	N	N
vg0332251368	A -> G	LOC_Os03g56620.1	intron_variant ; MODIFIER	silent_mutation	Average:76.421; most accessible tissue: Callus, score: 80.691	N	N	N	N

Showing 1 to 5 of 5 entries

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0332251368:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact